• No results found

Available online at ScienceDirect. Rice Science, 2015, 22(2): 65 70

N/A
N/A
Protected

Academic year: 2021

Share "Available online at ScienceDirect. Rice Science, 2015, 22(2): 65 70"

Copied!
6
0
0

Loading.... (view fulltext now)

Full text

(1)

ScienceDirect

Rice Science, 2015, 22(2): 65−70

Functional Marker Development and Effect Analysis of Grain

Size Gene GW2 in Extreme Grain Size Germplasm in Rice

Z

HANG

Ya-dong, Z

HENG

Jia, L

IANG

Yan-li, Z

HAO

Chun-fang, C

HEN

Tao, Z

HAO

Qing-yong,

Z

HU

Zhen, Z

HOU

Li-hui, Y

AO

Shu, Z

HAO

Ling, Y

U

Xing, W

ANG

Cai-lin

(Institute of Food Crops, Jiangsu Academy of Agricultural Sciences, Jiangsu High Quality Rice R & D Center, Nanjing Branch of

China National Center for Rice Improvement, Nanjing 210014, China)

Abstract: GW2 is an important gene that regulates grain width and weight. We used cDNA clone to

obtain the sequences of GW2 from large- and small-grained rice varieties, TD70 and Kasalath, respectively. Then, we developed a dCAPS (derived cleaved amplified polymorphic sequence) marker on the basis of the sequence difference between functional and nonfunctional GW2 genes to analyze the genotypes and phenotypes of recombinant inbred lines. Results showed that the sequence of GW2TD70 had a single nucleotide deletion at site 316 that generates a termination codon. This codon terminated the GW2 protein in advance. By contrast, the sequence of GW2Kasalath encoded an intact protein. A novel dCAPS marker was designed in accordance with a base A deletion at site 316 of the sequence. After the PCR product was digested by ApoI, TD70 showed 21 and 30 bp fragments, and Kasalath showed a 51 bp fragment. Up to 82 lines contained GW2TD70, and 158 lines contained GW2Kasalath. The lines that contained TD70 alleles displayed substantial increases in width and 1000-grain weight. This result suggested that

GW2 played a critical role in rice breeding.

Key words: rice; grain size; GW2 gene; derived cleaved amplified polymorphic sequence; phenotype Rice is an important crop worldwide. Over the past

half century, the yield of rice was doubled in most areas (Xing and Zhang, 2010). Rice yield is principally determined by panicle number, grain number per panicle, and grain weight. Grain weight depends on grain length, width and thickness. Grain size is closely related to the yield and quality of rice (Xu et al, 2004). Therefore, elucidating the genetic and developmental mechanisms of grain size is significant for high-yield breeding (Huang et al, 2013; Zuo and Li, 2014).

Numerous scholars have constructed high-density genetic linkage maps (Kurata et al, 1994; McCouch et al, 1988, 2002) by using molecular markers, such as restriction fragment length polymorphism and simple sequence repeat. Many genes and quantitative trait loci (QTLs) that control grain shape have been mapped to

12 chromosomes of rice (Gao et al, 2011), but only a few of these genes and QTLs have been cloned or fine mapped. To date, only GS5 (Li et al, 2011), GS3 (Fan et al, 2006; Mao et al, 2010), GW2 (Song et al, 2007),

GW5 (Weng et al, 2008), qSW5 (Shomura et al, 2008),

qGL3 (Zhang et al, 2012), GW8 (Wang et al, 2012) and TGW6 (Ishimaru et al, 2013; Wang et al, 2014) have been cloned.

GW2 is a major gene that controls grain width and weight (Song et al, 2007). This gene is cloned from the BC3F2 population derived from a cross of two

parents (large-grained japonica variety WY3 and small-grained indica variety FAZ1). Sequence analysis indicates that a base deletion exists in the 4th exon of the GW2 allele in WY3. This deletion results in the loss of 310 amino acid (AA) residues and premature termination of proteins. GW2 encodes a novel

Received: 16 September 2014; Accepted: 27 October 2014 Corresponding author: WANG Cai-lin ([email protected])

Copyright © 2015, China National Rice Research Institute. Hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of China National Rice Research Institute.

http://dx.doi.org/10.1016/S1672-6308(14)60280-8

Copyright © 2015, China National Rice Research Institute. Hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

Peer review under responsibility of China National Rice Research Institute http://dx.doi.org/10.1016/j.rsci.2015.05.007

(2)

RING-type E3 ubiquitin ligase that negatively regulates cell division through anchoring its substrate on a proteasome for degradation. The deletion of AAs in the large-grained rice variety disables GW2 from binding with its substrate and controlling ubiquitin-mediated protein degradation. As a result, the number of cells is increased, and they divide in the floret lemma. Then, the grain weight increases with respect to the positively regulated grain width of the floret lemma.

This study used a novel large-grained japonica variety TD70 and a small-grained indica variety Kasalath as the materials (Zhang et al, 2013). On the basis of the published sequence of GW2, these two varieties were cloned and analyzed by homology cloning. Subsequently, a functional marker of GW2 was designed to analyze the phenotypes and genotypes of 240 recombinant inbred lines (RILs). This work determined whether or not the premature termination of the GW2-encoded protein resulted in the large grain size of TD70 as observed in WY3. This study may be served as a theoretical basis for applying the GW2 of TD70 in the molecular technique assisted breeding of rice.

MATERIALS AND METHODS

Rice materials

Japonica variety TD70 [an extra-large grain derived from Tianegu///9520//(72-496/Yu-nuo)], indica variety Kasalath (a small grain), and a RIL population consisting of 240 lines derived from the cross of these two varieties were used as materials (Dong et al, 2012; Zhang et al, 2013).

Phenotype investigation

Grain length, width, thickness and 1000-grain weight were measured. The single grain length, width and thickness were measured using a Vernier caliper (to 0.01 mm). The mean value of each trait was regarded as the phenotypic value, which was determined by five randomly selected full grains per plant from five plants of each line. Harvested grains were sun-dried and then stored for more than 30 d to maintain a water content of approximately 14%. The total weight of 100 grains from each plant was measured and converted to its 1000-grain weight by using an electronic balance (to 1/10 000 g). The final 1000-grain weight of each line was determined by the mean value

of five plants each line.

Plant total RNA isolation and cDNA synthesis

The total RNA of 0.1 g mixture of leaves from water-cultivated rice seedlings, roots and seeds was isolated in accordance with the standard procedure provided by OMEGA’s Plant RNA Kit (Omega Bio-Tek Inc, USA). After treatment with DNase I, the quality of RNA was detected by gel electrophoresis and spectrophotometry. First-strand cDNA was synthesized from these detected RNA by a RevertAid First-Strand cDNA synthesis kit (Fermentas, USA) and recycled by a gel extraction kit (AXYGEN, USA).

GW2 gene cloning

Reverse transcripted cDNA was used as template to amplify GW2 by PCR. The thermal profile was as follows: 30 cycles of 98 °C for 30 s, 54 °C for 30 s, and 72 °C for 2 min.

PCR product purification and clone screening

The PCR product was analyzed by 1% agarose gel electrophoresis and then purified. The product was cloned into the pGEM-T vector then transformed into

E. coli strain DH5α by heat shock. The blue/white screening method was performed to select positive clones, which were further confirmed by PCR. The thermal profile was as follows: 94 °C for 5 min, 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 1 min, followed by a final extension at 72 °C for 5 min. Approximately 10 replicates were purified and sequenced.

Bioinformatics analysis about GW2 sequence

NCBI blast website (http://www.ncbi.nlm.nih.gov) was used to seek for similar sequences, and DNAMAN software was performed to predict the open reading frame of this gene. The number and composition of AAs, relative molecular weight of proteins, theoretical isoelectric point, and functional locations were analyzed by ExPASy ProtParam (http://www.expasy.org). Moreover, protein domains were predicted by EMBL-EBI (http://www.ebi.ac.uk).

RESULTS

Full-length cloning and sequence analysis of GW2

The following primers were designed on the basis of the published GW2 sequence (GenBank accession:

(3)

EF447275): forward, 5′-ATGGGGAACAGGATAGG GGGGAG-3′; reverse, 5′-CTACAACCATGCCAACC CTTGCGAG-3′. This pair of primer was verified to be specific by NCBI primer blast. The primer amplified a fragment of 1 277 bp and 1 278 bp in TD70 and Kasalath (Fig. 1), respectively. Both of these fragments were highly homologous to the known

GW2 gene. A T-to-C substitution occurred at the 114th position, which did not change the properties of the AAs. However, an A-deletion at the 316th position changed the AAs after the said position and caused a premature termination of the GW2-encoded protein at the 346th position. This result indicated that the GW2 in TD70 only encoded a 115 AA protein. By contrast, a whole-length GW2 protein of 424 AAs was expressed in Kasalath with 99.92% similarity to published sequence.

Protein sequence analysis and physiochemical property prediction of GW2

The formula of the GW2-encoded protein in TD70 was determined by the ProtParam software as C570H914N160O161S13 with 13 kD molecular weight. Its

theoretical isoelectric point was 8.75 containing 12 negative AA residues (Asp + Glu) and 17 positive AA residues (Arg + Lys). The stability index II of this protein was 54.46; thus, it was deemed unstable. Meanwhile, the formula of the GW2-encoded protein in Kasalath was determined as C2024H3154N584O647S43,

which was also deemed unstable with a stability index II of 72.71. This protein possessed a molecular weight of 47 kD and a theoretical isoelectric point of 5.32 because of 59 negative AA residues and 45 positive Fig. 1. Sequences of the cloned GW2 cDNA in TD70 and its deduced amino acid sequences.

The gray shadow indicates predicted open reading frame; The position of arrows points to one base deletion. ATGGGGAACAGGATAGGGGGGAGGAGGAAGGCGGGGGTGGAGGAGAGGTACACGAGG M G N R I G G R R K A G V E E R Y T R CCGCAGGGGCTGTACGAGCACAGGGACATCGACCAGAAGAAGCTCCGGAAGCTGATCCTC P Q G L Y E H R D I D Q K K L R K L I L GAGGCCAAGCTCGCGCCGTGCTACATGGGCGCCGACGACGCCGCCGCCGCCGCCGACCTC E A K L A P C Y M G A D D A A A A A D L GAGGAGTGCCCCATCTGCTTCCTGTACTACCCAAGTCTTAACCGATCAAAGTGTTGCTCA E E C P I C F L Y Y P S L N R S K C C S AAAGGGATATGCACCGAGTGCTTTCTCCAAATGAAACCAACTCACACTGCTCAGCCTACA K G I C T E C F L Q M K P T H T A Q P T CAATGTCCATTCTGCAAA

CTCCCAGTTATGCTGTGGAGTATCGTGGTGTAAAGACAAAGG Q C P F C K L P V M L W S I V V * AGGAAAGGAGCATAGAACAATTTGAAGAGCAGAAAGTCTAGAAGCACAAATGAGGATGCGCC AGCAAGCACTTCAAGATGAAGAAGATAAGATGAAAAGAAAACAGAACAGGTGCTCTTCTAGCA GAACAATCACACCGACCAAAGAAGTGGAGTATAGAGATATTTGCAGCACATCCTTTTCAGTGCC GTCATACCGATGTGCTGAGCAAGAAACTGAATGCTGTTCATCGGAACCTTCATGCTCTGCCCAG ACTAGCATGCGCCCTTTCCATTCTAGGCATAACCGTGATGATAACATTGACATGAATATAGAGG ATATGATGGTTATGGAAGCGATTTGGCGTTCCATTCAGGAGCAGGGAAGTATAGGGAATCCTGT CTGTGGCAACTTTATGCCTGTAACTGAGCCATCTCCGCGTGAACCCAGCCATTCGTTCCAGCTGC TTCTCTAGAAATACCTCATGGTGGTGGATTTTCCTGTGCGGTTGCGGCAATGGCTGAGCACCAG CCACCCAGTATGGACTTCTCTTACATGGCTGGCAGCAGCGCATTCCCAGTTTTCGACATGTTCCG GCGACCATGCAACATTGCTGGTGGAAGCATGTGTAATCTGGAGAGCTCACCGGAGAGCTGGAG CGGGATAGCACCAAGCTGCAGCAGGGAAGTGGTAAGAGAAGAAGGAGAGTGCTCGGCTGACC ACTGGTCGGAGGGTGCAGAGGCCGGAACAAGCTACGCGGGCTCAGACATCGTGGCAGATGCCG GGACCATGCCGCAGCTGCCTTTCGCCGAGAACTTCGCCATGGCGCCAAGCCACTTCCGCCCGGA GAGCATCGAAGAACAGATGATGTTTTCCATGGCTCTTTCTTTAGCAGATGGTCATGGAAGAACA CACTCGCAAGGGTTGGCATGGTTGTAG

(4)

AA residues.

The GW2-encoded proteins in both TD70 and Kasalath contained a RING-type zinc finger domain and exhibited an E3 ubiquitin ligase activity, although the protein in TD70 was only partially expressed for 115 AAs (Fig. 2).

Functional marker design of GW2 gene

Multiple differences were detected between the GW2 sequences in TD70 and Kasalath. These differences included the critical A-deletion at the 316th position. A dCAPS marker was designed on the basis of this deletion. The following primers were used: GW2SNP2-F1, CTACACAATGTCCATTCTGCAAAT; GW2SNP2-R1, CCACGATACTCCACAGCATAACT. The sequence in Kasalath can be amplified by the above primers for only 51 bp, whereas that in TD70 can be specifically cleaved into two fragments, 21 and 30 bp, by the restriction endonuclease ApoI (Fig. 3).

Phenotype of grain size in TD70, Kasalath and RILs

The 1000-grain weight, grain length, width and thickness in TD70, Kasalath and RILs were investigated during 2012 to 2013. These phenotypic traits are listed in Table 1. However, these traits varied because of factors such as cultivation, light and temperature, especially plumpness and 1000-grain weight in TD70. The 1000-grain weights of TD70 were 65 and 61 g in 2012 and 2013, respectively. By contrast, variations in grain length, width and thickness remained minimal. The mean values of grain length, width and thickness were 13.35 and 8.06 mm, 4.36 and 2.48 mm, and 63.00 and 17.60 g for TD70 and Kasalath, respectively. For the RIL population, the mean values of grain width and 1000-grain weight in 2012 and 2013 were 3.12 mm and 29.82 g, respectively. Both of these values in the RIL population were between the parental materials. Therefore, these values significantly differed from the

grain sizes of TD70 and Kasalath.

GW2 genotype and phenotype of different lines

The molecular marker of GW2 was used to detect the distribution of GW2 in the RIL population derived from TD70 and Kasalath. Results showed that in the 240 RILs, 82 lines contained GW2TD70 and 158 contained GW2Kasalath. Corresponding phenotypes of these RILs were investigated (Table 2). The mean grain widths of lines containing GW2TD70 were (3.43 ± 0.33) and (3.44 ± 0.33) mm in 2012 and 2013, respectively. In addition, the mean grain widths of lines containing GW2Kasalath were (2.96 ± 0.26) and (2.93 ± 0.25) mm, respectively. Furthermore, the mean 1000-grain weight of RILs containing GW2TD70 was 5.54 to 6.05 g heavier than those containing

GW2Kasalath. This result further indicated that the expression of GW2 is important for grain width and weight in all the lines.

DISCUSSION

Diversity of GW2 homologous genes on grain

The GW2 gene of rice reportedly increases grain width, weight, yield and accelerates filling process (Bai et al, 2012; Dixit et al, 2013; Lu et al, 2013). However,

AtGW2, the homologous gene of OsGW2 in

Arabidopsis thaliana, encodes a RING-C2 E3

Table 1. Mean values of grain traits in recombinant inbred lines (RILs) and their parents in two years.

Type Year KGW (g) GL (mm) GW (mm) GT (mm) TD70 2012 65.00 ± 2.35 13.40 ± 0.08 4.42 ± 0.25 2.99 ± 0.05 2013 61.00 ± 2.04 13.29 ± 0.15 4.29 ± 0.05 2.93 ± 0.15 Kasalath 2012 17.40 ± 0.66 8.04 ± 0.26 2.48 ± 0.07 1.84 ± 0.08 2013 17.80 ± 0.53 8.07 ± 0.09 2.48 ± 0.04 1.90 ± 0.01 RIL 2012 31.20 ± 7.18 9.83 ± 1.24 3.12 ± 0.36 2.11 ± 0.16 2013 28.43 ± 6.46 9.68 ± 1.22 3.11 ± 0.37 2.17 ± 0.18 KGW, 1000-grain weight; GL, Grain length; GW, Grain width; GT, Grain thickness.

Table 2. Grain phenotype of lines with different GW2 genotype in recombinant inbred lines (RILs).

Genotype Year No. of

RILs KGW (g) GL (mm) GW (mm) GT (mm)

GW2TD70 2012 82 35.18 ± 7.28 9.96 ± 1.26 3.43 ± 0.33 2.23 ± 0.14 2013 82 32.08 ± 6.16 9.82 ± 1.21 3.44 ± 0.33 2.32 ± 0.15

GW2Kasalath 2012 158 29.13 ± 6.22 9.77 ± 1.23 2.96 ± 0.26 2.04 ± 0.12

2013 158 26.54 ± 5.78 9.61 ± 1.22 2.93 ± 0.25 2.10 ± 0.14 KGW, 1000-grain weight; GL, Grain length; GW, Grain width; GT, Grain thickness.

Fig. 3. PCR amplification of GW2 with its functional marker in TD70, Kasalathand parts of recombinant inbred lines (RILs). M, 50 bp Marker; T, TD70; K, Kasalath; Lanes 1–4, Parts of RILs.

51 bp

30 bp

21 bp 50 bp

(5)

ubiquitin ligase composed of 401 AAs, which negatively regulates its grain size and weight (Jiang et al, 2011). TaGW2, another homologous gene of

OsGW2 in wheat, does not cause variations in grain size. However, two single nucleotide polymorphisms in the promoter region of TaGW2 influence changes in grain width and weight in wheat, and quantitative real-time PCR showed that these grain size variations are regulated by different expression levels of TaGW2 (Su et al, 2011). HvGW2 in barley is highly homologous to the GW2 of other plants, especially to that of wheat. Sequence analysis revealed that two types of retrotransposons inserted at the 6th intron were critical to the change in transcription level by increasing gene length. This effect makes GW2 in barley 11.5 kb longer than others (Guo et al, 2013). ZmGW2 in maize contains a RING-finger domain and involves an E3 ligase-related biological reaction, but its expression level is negatively related to the yield. ZmGW2 has multiple functions under stress conditions and in the developmental process (Li et al, 2010; Liu et al, 2013). The mechanism of this regulation differs from the single nucleotide mutation in rice. In summary, the mechanisms of GW2 in regulating grain size vary among barley, wheat, maize, Arabidopsis and rice.

GW2 gene function in extreme materials

A relatively high homology was found between the cloned GW2 from TD70 and WY3. Both proteins have a T-to-C inversion at the 114th position with no AA functional change and premature termination at the 346th position. This description indicates that GW2 in TD70 has the same function as that in WY3 (Song et al, 2007). Despite the premature termination of protein sequence, the truncated part contains the complete RING-type zinc finger domain. The loss of domain after the termination inactivates the protein because of the absence of substrates. Therefore, GW2TD70 increases grain width and weight in TD70.

Effect and application potential of GW2

The cloned grain gene GS3, which controls grain length in most indica varieties, has a relatively high breeding value (Takano-Kai et al, 2009, 2011; Wang et al, 2011). Original rice materials with functional

GW2 gene have been rarely identified; thus, this gene is rarely reported and characterized (Song et al, 2007). The present study proved that GW2TD70 exerted strong favorable effects on the RIL population derived from cross between TD70 and Kasalath. This gene is also

crucial in determining grain width and grain weight; thus, the GW2 gene of TD70 is valuable in breeding.

ACKNOWLEDGEMENTS

This work was supported by the National Natural Science Foundation of China (Grant No. 31271678), the Jiangsu Agricultural Scientific Self-Innovation Fund (Grant No. CX[12]1003), and Jiangsu Province Agricultural Science and Technology Support Program (Grant No. BE2013301).

REFERENCES

Bai X F, Wu B, Xing Y Z. 2012. Yield-related QTLs and their applications in rice genetic improvement. J Integr Plant Biol, 54(5): 300–311.

Dixit N, Dokku P, Amitha Mithra S V, Parida S K, Singh A K, Sing N K, Mohapatra T. 2013. Haplotype structure in grain weight gene GW2 and its association with grain characteristics in rice. Euphytica, 192(1): 55–61.

Dong S L, Zhang Y H, Zhang Y D, Chen T, Zhao Q Y, Zhu Z, Zhou L H, Yao S, Zhao L, Wang C L. 2012. Construction of molecular genetic linkage map based on a rice RIL population and detection of QTL for tiller angle. Jiangsu J Agric Sci, 28(6): 236–242. (in Chinese with English abstract)

Fan C C, Xing Y Z, Mao H L, Lu T T, Han B, Xu C G, Li X H, Zhang Q F. 2006. GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor Appl Genet, 112(6): 1164−1171.

Gao Z Q, Zhan X D, Liang Y S, Cheng S H, Cao L Y. 2011. Progress on genetics of rice grain shape trait and its related gene mapping and cloning. Hereditas, 33(4): 314–321. (in Chinese with English abstract)

Guo G G, Dong G Q, Zhou J, Dawa D Z, Yuan X M, Zhang J. 2013. Three-dimensional pooling and HvGW2 gene screening of barley (Hordeum vulgare L.) BAC library. Sci Agric Sin, 46(1): 9–17. (in Chinese with English abstract)

Huang R Y, Jiang L R, Zheng J S, Wang T S, Huang Y M, Hong Z L. 2013. Genetic bases of rice grain shape: So many genes, so little known. Trends Plant Sci, 18(4): 218–226.

Ishimaru K, Hirotsu N, Madoka Y, Murakami N, Hara N. 2013. Loss of function of the IAA-glucose hydrolase gene TGW6 enhances rice grain weight and increases yield. Nat Genet, 45: 707–711.

Jiang Y, Cao Y Y, Lu Y C, Tang B J, Wang L F, Li H Y. 2011. Cloning and functional analysis of Arabidopsis thaliana AtGW2, a RING-type E3 ubiquitin ligase protein. J Plant Genet Resour, 12(3): 448–454. (in Chinese with English abstract)

Kurata N, Nagamura Y, Yamamoto K, Kurata N, Nagamura Y, K Yamamoto, Y Harushima, Sue N, Wu J, Antonio B A, Shomura A, Shimizu T, Lin S Y, Inoue T, Fukuda A, Shimano T, Kuboki Y,

(6)

Toyama T, Miyamoto Y, Kirihara T, Hayasaka K, Miyao A, Monna L, Zhong H S, Tamura Y, Wang Z X, Momma T, Umehara Y, Yano M, Sasaki T, Minobe Y. 1994. A 300 kilobase interval genetic map of rice including 883 expressed sequences.

Nat Genet, 8(4): 365–372.

Li Q, Li L, Yang X H, Warburton M L, Bai G H, Dai J R, Li J S, Yan J B. 2010. Relationship, evolutionary fate and function of two maize co-orthologs of rice GW2 associated with kernel size and weight. BMC Plant Biol, 10(1): 143.

Li Y B, Fan C C, Xing Y Z, Jiang Y H, Luo L J, Sun L, Shao D, Xu C J, Li X H, Xiao J H, He Y Q, Zhang Q F. 2011. Natural variation in GS5 plays an important role in regulating grain size and yield in rice. Nat Genet, 43(12): 1266–1269.

Liu F F, Jiang Y, Cao Y Y, Li H Y. 2013. Expression pattern assay of ZmGW2, a RING-domain E3 ubiquitin ligase gene in maize. J

Maize Sci, 21(2): 47–51. (in Chinese with English abstract) Lu L, Shao D, Qiu X J, Sun L, Yan W H, Zhou X C, Yang L, He Y

Q, Yu S B, Xing Y D. 2013. Natural variation and artificial selection in four genes determine grain shape in rice. New Phytol, 200(4): 1269–1280.

Mao H L, Sun S Y, Yao J L, Wang C R, Yu S B, Xu C G, Li X H, Zhang Q F. 2010. Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc Natl

Acad Sci USA, 107(45): 19579–19584.

McCouch S R, Kochert G, Yu Z H, Wang Z Y, Khush G S, Coffman W R, Tanksley S D. 1988. Molecular mapping of rice chromosomes. Theor Appl Genet, 76(6): 815–829.

McCouch S R, Teytelman L, Xu Y, Lobos K B, Clare K, Walton M, Fu B, Maghirang R, Li Z, Xing Y Z, Zhang Q F, Kono I, Yano M, Fjellstrom R, DeClerck G, Schneider D, Cartinhour S, Ware D, Stein L. 2002. Development and mapping of 2240 new SSR markers for rice (Oryza sativa L.). DNA Res, 9(6): 199–207. Shomura A, Izawa T, Ebana K, Ebitani T, Kanegae H, Konishi S,

Yano M. 2008. Deletion in a gene associated with grain size increased yields during rice domestication. Nat Genet, 40: 1023–1028. Song X J, Huang W, Shi M, Zhu M Z, Lin H X. 2007. A QTL for

rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat Genet, 39(5): 623–630. Su Z Q, Hao C Y, Wang L F, Dong Y C, Zhang X Y. 2011.

Identification and development of a functional marker of TaGW2 associated with grain weight in bread wheat (Triticum aestivum

L.). Theor Appl Genet, 122(1): 211–223.

Takano-Kai N, Jiang H, Kubo T, Sweeney M, Matsumoto T, Kanamori H, Padhukasahasram B, Bustamante C, Yoshimura A, Doi K, McCouch S. 2009. Evolutionary history of GS3, a gene conferring grain length in rice. Genetics, 182(4): 1323–1334. Takano-Kai N, Doi K, Yoshimura A. 2011. GS3 participates in

stigma exsertion as well as seed length in rice. Breeding Sci, 61(3): 244–250.

Wang C R, Chen S, Yu S B. 2011. Functional markers developed from multiple loci in GS3 for fine marker-assisted selection of grain length in rice. Theor Appl Genet, 122: 905–913.

Wang J, Yang J, Xu X, Zhu J Y, Fan F J, Li W Q, Wang F Q, Zhong W G. 2014. Development and application of a functional marker for grain weight gene TGW6 in rice. Chin J Rice Sci, 28(5): 473–478. (in Chinese with English abstract)

Wang S K, Wu K, Yuan Q B, Liu X Y, Liu Z B, Lin X Y, Zeng R Z, Zhu H T, Dong G J, Qian Q, Zhang G Q, Fu X D. 2012. Control of grain size, shape and quality by OsSPL16 in rice. Nat

Genet, 44(8): 950–954.

Weng J F, Gu S H, Wan X Y, Gao H, Guo T, Su N, Lei C L, Zhang X, Cheng Z J, Guo X P, Wang J L, Jiang L, Zhai H Q, Wan J M. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Res, 18(12): 1199–1209.

Xing Y Z, Zhang Q F. 2010. Genetic and molecular bases of rice yield. Annu Rev Plant Biol, 61: 421–442.

Xu Z J, Chen W F, Ma D R, Lu Y N, Zhou S Q, Liu L X. 2004. Correlations between rice grain shapes and main qualitative characteristics. Acta Agron Sin, 30(9): 894–900. (in Chinese with English abstract)

Zhang X J, Wang J F, Huang J, Lan H X, Wang C L, Yin C F, Wu Y Y, Tang H J, Qian Q, Li J Y, Zhang H S. 2012. Rare allele of

OsPPKL1 associated with grain length causes extra-large grain and a significant yield increase in rice. Proc Natl Acad Sci USA, 109(52): 21534–21539.

Zhang Y D, Zhang Y H, Dong S L, Chen T, Zhao Q Y, Zhu Z, Zhou L H, Yao S, Zhao L, Yu X, Wang C L. 2013. QTL mapping for grain size traits based on extra-large grain rice line TD70. Rice Sci, 20(6): 400–406.

Zuo J R, Li J Y. 2014. Molecular genetic dissection of quantitative trait regulating rice grain size. Annu Rev Genet, 48: 99–118.

References

Related documents

Packages that warehouse team members in materials management, and writing your cover letter template for maintaining the ability.. Transfers with warehouse supervisor letter is a

Time Index would be a preferred travel time reliability measure since it is based on average travel time; for those who are not familiar with that, planning time index may

On the off chance that Lewy bodies create in a piece of the cerebrum called the mind stem, and indications of dementia, somebody may likewise create manifestations like

Keywords: Flexible pavement, Benkelman Beam, 5 th wheel bump integrator, unevenness index, correlation,..

In developed countries widespread universal vaccination of infants has dramatically decreased the incidence of pertussis, especially hospitalisation and death, among those aged

Relationships between age, sex, physiological variables, symptoms, physical function, and subjective health status Patients with less breathlessness and depression reported

Energy Balance (TSEB) model for estimating daytime ET using tower-based land surface 18.. temperature measurements over two Pinot Noir (Vitis vinifera ) vineyards at different

A regulatory threshold is a specified concentration of the medication or a derivative thereof in plasma or urine, whereas a withdrawal time guideline is a suggested time before an