0095-1137/08/$08.00
⫹
0
doi:10.1128/JCM.02246-07
Automated and Manual Methods of DNA Extraction for
Aspergillus fumigatus
and
Rhizopus oryzae
Analyzed by
Quantitative Real-Time PCR
䌤
Andrea Francesconi,
1Miki Kasai,
1Susan M. Harrington,
2Mara G. Beveridge,
1Ruta Petraitiene,
1,3Vidmantas Petraitis,
1,3Robert L. Schaufele,
1and Thomas J. Walsh
1*
National Cancer Institute, National Institutes of Health, Bethesda, Maryland
1; NIH Clinical Center, NIH, Bethesda, Maryland
2;
and LASP, SAIC-Frederick Inc., Frederick, Maryland
3Received 20 November 2007/Returned for modification 31 December 2007/Accepted 4 March 2008
Quantitative real-time PCR (qPCR) may improve the detection of fungal pathogens. Extraction of DNA from
fungal pathogens is fundamental to optimization of qPCR; however, the loss of fungal DNA during the
extraction process is a major limitation to molecular diagnostic tools for pathogenic fungi. We therefore
studied representative automated and manual extraction methods for
Aspergillus fumigatus
and
Rhizopus oryzae
.
Both were analyzed by qPCR for their ability to extract DNA from propagules and germinated hyphal elements
(GHE). The limit of detection of
A. fumigatus
and
R. oryzae
GHE in bronchoalveolar lavage (BAL) fluid with
either extraction method was 1 GHE/ml. Both methods efficiently extracted DNA from
A. fumigatus
, with a limit
of detection of 1
ⴛ
10
2conidia. Extraction of
R. oryzae
by the manual method resulted in a limit of detection
of 1
ⴛ
10
3sporangiospores. However, extraction with the automated method resulted in a limit of detection of
1
ⴛ
10
1sporangiospores. The amount of time to process 24 samples by the automated method was 2.5 h prior
to transferring for automation, 1.3 h of automation, and 10 min postautomation, resulting in a total time of 4 h.
The total time required for the manual method was 5.25 h. The automated and manual methods were similar
in sensitivity for DNA extraction from
A. fumigatus
conidia and GHE. For
R. oryzae
, the automated method was
more sensitive for DNA extraction of sporangiospores, while the manual method was more sensitive for GHE
in BAL fluid.
The detection and identification of medically important
fil-amentous fungi in immunocompromised and diabetic patients
may be limited by low sensitivity and time-consuming methods.
Invasive pulmonary aspergillosis is an important cause of
mor-bidity and mortality in patients with hematological malignancy
and transplantation (1, 3, 7, 14, 23, 24, 28, 29). The most
common cause of invasive infection by an
Aspergillus
species is
infection by
Aspergillus fumigatus
(31, 38). When the organism
is inhaled by an immunocompromised host, uninhibited
ger-mination of conidia into hyphae may result in pulmonary tissue
hemorrhage and infarction (35). However, the diagnostic yield
of bronchoalveolar lavage (BAL) fluid for the diagnosis of
invasive pulmonary aspergillosis using conventional
microbio-logical methods is relatively low (33, 36).
The number of cases of zygomycosis has increased over the
last six decades, making diagnosis of these infections a
neces-sity (20, 32, 34). In the immunocompromised host, rapid
pro-gression of pneumonia and dissemination are frequently due to
the inhalation of sporangiospores, which contributes to the
high mortality rate (76%), underscoring the urgency of making
a rapid and accurate diagnosis of pulmonary zygomycosis (16,
17, 27, 32). Even when both culture and histopathologic
anal-ysis of BAL fluid are performed, many suspected infections are
not confirmed. Roden et al. found that
Rhizopus
spp. were the
most commonly recovered organisms among 218
microbiolog-ically defined infections (32). Given the increase in the number
of these infections in recent years, a molecular approach to
detection of zygomycete molds may increase sensitivity and
rapid diagnosis, resulting in earlier therapy.
Thus, there is a need for the development of more sensitive
and more rapid techniques that would aid in the early diagnosis
of patients with these life-threatening infections and improve
clinical outcomes. Currently, the use of real-time PCR is a
standard method accepted for the detection of nucleic acids
from many microorganisms in clinical samples. Although
widely used for detection of many viruses and mycobacteria,
quantitative real-time PCR (qPCR) is not yet similarly
ac-cepted in clinical mycology laboratories. A lack of standardized
methods for diagnostic PCR of medically important fungi has
led to divergent results (4). Nevertheless, the application of
diagnostic PCR to BAL fluid in immunocompromised patients
with suspected fungal pneumonia appears to be promising (5,
15, 19).
The use of an efficient, rapid, standardized method of DNA
extraction from the pathogen is a fundamental component for
the optimization and reproducibility of qPCR assays (15, 18).
The sensitivity of any PCR assay for the detection of fungal
pathogens ultimately depends on efficient lysis of fungal cells
from biological samples and purification of DNA that is free of
inhibitors (11). Filamentous fungi have complex cell walls
con-sisting of chitin, (1
3
3)-

-
D-glucan, (1
3
6)-

-glucan, lipids,
and peptides that are difficult to disrupt, thus requiring
rigor-* Corresponding author. Mailing address: Immunocompromised
Host Section, Pediatric Oncology Branch, National Cancer Institute,
Bldg. 10-CRC, Rm. 1-5740, Bethesda, MD 20892. Phone: (301)
402-0023. Fax: (301) 480-2308. E-mail: [email protected].
䌤
Published ahead of print on 19 March 2008.
1978
on May 16, 2020 by guest
http://jcm.asm.org/
ous extraction methods. These methods are time-consuming
and therefore reduce the ability for rapid diagnosis. The
effi-ciency of extraction of fungal DNA may vary considerably
depending on the method chosen (9, 11, 13, 15, 25). Thus, the
extraction method chosen may often represent a compromise
between efficiency, lack of exogenous contamination, and the
ability to be adapted by routine high-throughput laboratories
(15).
The development and availability of automated techniques
for DNA extraction and product detection may facilitate
fun-gal DNA detection in clinical diagnostic laboratories (4, 15).
Thus, given the importance of developing optimal DNA
ex-traction methods for diagnostic PCR assays, we investigated
both automated and manual methods for their ability to extract
DNA from germinated hyphal elements (GHE) of
A.
fumiga-tus
and
Rhizopus oryzae
in normal rabbit BAL fluid. BAL fluid
was selected because it is a common clinical specimen
submit-ted for detection of fungi causing lower respiratory tract
infec-tions and in which the organism may exist as GHE and spores.
DNA also was extracted from conidia and sporangiospores for
quantitation from fungal propagules. The analytical yield and
sensitivity of each extraction method were determined by
qPCR.
MATERIALS AND METHODS
Organism.The organisms,A. fumigatus(NCI 4215, ATCC MYA-1163) andR. oryzae(NCI 98), were subcultured from frozen slants (stored at⫺70°C) onto Sabouraud dextrose agar slants (K-D Medical, Inc., Columbia, MD) and incu-bated for 24 h at 37°C. The slants were then incuincu-bated at room temperature for an additional 5 days before harvesting. Conidia and sporangiospores were har-vested under a laminar airflow hood with a solution of 0.025% Tween 20 (Fisher Scientific, Fair Lawn, NJ) in normal saline (K-D Medical, Inc., Columbia, MD), filtered, washed, and counted on a hemacytometer.
DNA extraction of GHE in normal rabbit BAL fluid.BAL fluid was obtained
as previously described (30).A. fumigatusandR. oryzaesamples were set up in
triplicate using a 24-well flat-bottom plate (Corning, Corning, NY). The
follow-ing were added to each well: 800l normal rabbit BAL fluid, 200l yeast
nitrogen broth (KD Medical, Columbia, MD), gentamicin (20g/ml; Hospira,
Inc., Lake Forest, IL), vancomycin (20g/ml; Hospira, Inc., Lake Forest, IL),
and 100l of conidia or sporangiospores (104, 103, 102, 101, or 100). Normal
rabbit BAL fluid samples, without any organism, were set up as negative controls using the same growth medium as described above. Samples were incubated at 37°C for 24 h. Germination was confirmed by visual inspection using an inverted microscope. Following incubation, the contents were harvested from individual
wells and placed into Fast Prep Lysing Matrix D (LMD) tubes (Q䡠BIOgene/MP
Biomedical, Morgan Irvine, CA) containing no lysing matrix (LM). Each well
was subsequently rinsed with 200l phosphate-buffered saline (PBS) (Quality
Biological, Inc., Gaithersburg, MD), and the well contents were added to cor-responding samples for DNA extraction. DNA extraction was performed imme-diately after harvesting in an AirClean PCR work station (AirClean Systems, Raleigh, NC).
Automated DNA extraction method.The MagNA Pure LC system can purify DNA from different biological samples by incorporating cell disruption and protein digestion, DNA binding to magnetic glass particles, removal of cellular debris by extensive washing, magnetic separation of the bead-DNA complex, and DNA elution.
BAL fluid samples were centrifuged for 10 min at 16,000⫻g, and supernatants
were discarded. An aliquot of 150l of spheroplast buffer (1.0 M sorbitol [Sigma
S-1876, St. Louis, MO], 50.0 mM sodium phosphate monobasic [Sigma S-0751], 0.1% 2-mercaptoethanol [Sigma M-3148], 10 mg/ml lyticase [Sigma L-2524]), 10
l lysing enzymes (Novozyme [20 mg/ml; Sigma L-1412]), and LM were added to
each specimen. Samples were briefly vortexed and incubated at 30°C for 5 min at 1,200 rpm in an Eppendorf thermomixer (Eppendorf, Westbury, NY). Mixing was terminated and sample incubation continued for 25 min. Samples were
processed using a Fast Prep instrument (Q䡠BIOgene/MP Biomedical, Morgan
Irvine, CA) at speed 5 for 30 s and placed on ice for 5 min; this process was performed a total of three times. Samples were equilibrated to room
tempera-ture and centrifuged for 1 min at 1,000⫻g. The samples were then processed
with a MagNA Pure LC instrument using a MagNA Pure LC DNA isolation kit III (bacteria, fungi) (Roche Applied Science, Indianapolis, IN) as recommended
by the manufacturer. Samples were eluted in 100l of kit elution buffer.
Manual DNA extraction method.The DNeasy Plant minikit is a spin column procedure that incorporates sample lysis, removal of RNA, removal of proteins and polysaccharides, DNA precipitation, and binding to the spin column mem-brane. Multiple washes are performed to remove contaminants, and DNA is then eluted from the membrane.
BAL fluid samples were centrifuged for 10 min at 16,000⫻g, and supernatants
were discarded. The samples were gently resuspended in 100l spheroplast
buffer plus 10l of lysing enzymes and incubated at 30°C in an Eppendorf
thermomixer for 45 min at 1,200 rpm. After centrifugation for 20 min at 400⫻
g, the spheroplast-BAL fluid pellets were resuspended in 400l AP1 buffer
(DNeasy Plant minikit, Qiagen, Valencia, CA). The samples were added to LMD tubes, processed using a Fast Prep instrument at speed 5 for 30 s, and placed on ice for 5 min (25). This process was performed a total of three times. Samples
were centrifuged at 16,000⫻gfor 60 s and then gently vortexed. The specimens
(approximately 300l) were transferred to new tubes. The beads in the LMD
tubes were rinsed with 100l AP1 buffer, and this wash was added to each
corresponding sample (resulting in a 400-l final volume). Four microliters of
RNase A (100 mg/ml) was added to each sample, vortexed vigorously, and incubated for 10 min at 65°C in an Eppendorf thermomixer at 1,200 rpm. The samples were further processed according to the DNeasy Plant minikit (Qiagen,
Valencia, CA) protocol with the following modification: after 200l preheated
(65°C) AE buffer was applied to the column, the entire apparatus (column and collection tube) was heated at 65°C in the Eppendorf thermomixer for 5 min (10, 26).
DNA extraction from conidia and sporangiospores.All DNA samples were extracted in an AirClean PCR work station. Genomic DNA was extracted from
10-fold serial dilutions (104
, 103
, 102
, 101
, and 100
) ofA. fumigatusconidia orR. oryzaesporangiospores suspended in PBS. An aliquot of 100l of each conidial or spore dilution was placed in LMD tubes without LM and centrifuged for 10
min at 16,000⫻g. The supernatant was gently removed from each sample, and
samples were further processed by either the automated or manual method as described above.
qPCR assays.When extracting with the automated method, the final eluate frequently may have residual cellular debris and a slight red color related to the magnetic particles [Roche Applied Science, MagNA Pure LC DNA isolation kit III (bacteria, fungi) user manual]. Therefore, prior to qPCR, all samples ex-tracted by either method were briefly vortexed and then centrifuged for 45 s at
4,500⫻gto pellet any particulates that might be present. If samples were not
centrifuged prior to qPCR, inhibition was often observed. An aliquot of 5l was
drawn from the surface of each DNA specimen and added to 15l of master mix
for qPCR. The master mixes were prepared in a biosafety cabinet located in a room different from where DNA extractions were performed. LightCycler car-ousel loading was performed in a room separate from where the PCR master mix was prepared.
Aspergillus fumigatusPCR assay.Both methods were analyzed for efficiency of
DNA extraction fromA. fumigatusconidia and GHE using theA.
fumigatus-specific qPCR assay described previously (10, 26). Briefly, the PCR master mix
consisted of 0.5M of each of the primers (Cap positive sense, 5⬘CGAAGAC
CCCAACATG3⬘; Cap negative sense, 5⬘TGAGGGCAGCAATGAC3⬘), 5 mM
MgCl2, 0.025% bovine serum albumin (Sigma), 0.025 U/ml PlatinumTaqDNA
polymerase (Invitrogen Corp., Carlsbad, CA), 10⫻ PCR buffer (Invitrogen
Corp., Carlsbad, CA), 0.2 mM PCR Nucleotide Mix Plus (1 dATP, dCTP, dGTP, and 3 dUTP in proportionate ratios; Roche Applied Science, Indianapolis, IN),
and 0.1M each of the fluorescein (5⬘AGTATGCAGTCTGAGTTGATTATC
G3⬘) and LC Red-640 (5⬘ATCAGTTAAAACTTTCAACAACGGA3⬘) probes.
To prevent potential amplicon carryover, each reaction mixture also contained
HK-UNG thermostable uracilN-glycosylase (Epicenter, Madison, WI) as
rec-ommended by the manufacturer. Each reaction mixture contained a 5-l aliquot
of extracted specimen, together with 15l of the master mix. The LightCycler 2.0
instrument (Roche Applied Science) was used with the following cycling condi-tions: uracil activation at 37°C for 180 s and uracil heat inactivation at 95°C for 60 s for 1 cycle; amplification cycles of denaturation at 95°C for 0 s (slope, 20°C/s), annealing at 58°C for 3 s (slope, 10°C/s), extension at 72°C for 15 s (slope, 3°C/s), and cool down at 40°C for 120 s. The total number of cycles was
45. Quantitation standards (10-fold serial dilutions ofA. fumigatusgenomic DNA
ranging from 1⫻105fg to 1⫻103fg) and a set of negative controls were run
in conjunction with each set of samples. The amplicon generated was 253 bp in
size. A crossover value ofⱕ36 cycles was considered positive (10).
on May 16, 2020 by guest
http://jcm.asm.org/
Rhizopusspecies PCR assay.Primers were chosen which anneal to the 28S
rRNA gene sequences within the generaRhizopus,Mucor, andRhizomucorbut
not to those in unrelated fungi, such asPenicillium,Aspergillus, orCandida, that
might also be present in clinical samples (S. M. Harrington, M. Kasai, A. Francesconi, R. Petraitiene, V. Petraitis, and T. J. Walsh, presented at the 107th General Meeting of the American Society for Microbiology, Toronto, Canada, 21 to 25 May 2007). Primers were designed using software available through the Whitehead Institute for Biomedical Research, MIT (http://frodo.wi.mit.edu
/primer3/input.htm). Primer sequences were as follows: Zygo-F1, 5⬘TTCAAAG
AGTCAGGTTGTTTGG3⬘, and Zygo-R1, 5⬘CAGTCTGGCTCCAAACGGT
TC3⬘(Midland Certified Reagent Co., Midland, TX). Hybridization fluorescence
resonance energy transfer probes were chosen using Oligo software (Molecular Biology Insights, Cascade, CO) and synthesized by Operon Biotechnologies, Inc.
(Huntsville, AL). Probe sequences for the zygomycete PCR were 5⬘GGCGAG
AAACCGATAGCGAAC-fluorescein isothiocyanate3⬘and 5⬘RD640-GTACCG
TGAG-GGAAAGATGAAAAGAACTTTGAAA3⬘.
Real-time PCR was performed with a LightCycler 2.0 instrument. The PCR
master mix consisted of 0.025% bovine serum albumin, 3 mM MgCl2, 0.025 U
PlatinumTaqDNA polymerase, 0.2⫻PCR buffer, 0.2 mM PCR Nucleotide Mix
Plus, 0.002 U/l HK-UNG, 0.25M of each primer, and 0.1M of each
RD640-and fluorescein isothiocyanate-labeled probe. To 15l of master mix, 5l of
extracted specimen was added. Uracil was released by incubating at 37°C for 900 s, and then enzyme was inactivated at 95°C for 180 s. Touchdown PCR cycling was performed as follows: 95°C denaturation for 0 s (20°C/s), followed by annealing in 1°C steps between 68°C and 54°C for 5 s (10°C/s), each with a 72°C extension of 15 s (3°C/s) for each cycle. Touchdown cycling was followed by 35 cycles of 95°C for 0 s (20°C/s), 54°C for 5 s (10°C/s), and 72°C for 15 s (3°C/s). A postamplification melt analysis was performed by cooling from 96°C to 40°C for 30 s (20°C/s), followed by a gradual increase in temperature (2°C/s) to 75°C for
0 s (0.2°C/s). Quantitation standards (10-fold serial dilutions ofR. oryzaegenomic
DNA ranging from 1⫻103
fg to 1⫻101
fg) were run in conjunction with each set of samples to assess assay sensitivity and linearity and qPCR results. The
amplicon generated was 180 bp in length. A crossover value ofⱕ22 cycles was
considered positive.
Inhibition studies.Separate PCRs were performed on all samples to test for
any inhibitors of PCR. A master mix consisting of theA. fumigatusprimers/
probes,A. fumigatusgenomic DNA, andR. oryzaesample DNA was used as
described above to test for inhibitors in theR. oryzaesamples. Conversely, the
master mix consisting of theR. oryzaeprimers/probes,R. oryzaegenomic DNA,
andA. fumigatussample DNA was used as described above to test for inhibitors
in theA. fumigatussamples. Presence of inhibitors was determined by comparing
the amplification efficiency of the spiked genomic DNA in the same reaction with the extracted experimental DNA samples against reaction mixtures containing just water. The presence of inhibition would result in a higher crossover value than those of water samples. No inhibition was observed in any of the samples.
Statistical analysis.Data are expressed as means and standard errors of the means. Sensitivity was assessed using categorical variables in two-by-two tables. Differences in proportions were determined by Fisher’s exact test. Yields of DNA from the two methods were assessed by differences in continuous variables
measured by the Mann-Whitney U test. APvalue ofⱕ0.05 was considered
significant.
RESULTS
Extraction of DNA from
Aspergillus fumigatus
conidia and
GHE.
Both methods extracted DNA from
A. fumigatus
conidia
in PBS, resulting in a lower limit of detection of 1
⫻
10
2conidia. There was no significant difference in the amount of
DNA amplified at this level of detection (Fig. 1A). When DNA
was extracted from
A. fumigatus
GHE in BAL fluid, both
extraction methods resulted in a level of detection of 1
⫻
10
0GHE/ml (Fig. 1B). At this level of detection, the automated
method demonstrated a trend toward greater sensitivity in
percent yield of positive samples (
P
⫽
0.08) (Table 1). At a
given concentration of 1 GHE/ml, the automated method
ex-tracted more DNA than did the manual method (
P
⫽
0.008)
(Fig. 1B).
Extraction of DNA from
Rhizopus oryzae
sporangiospores
and GHE.
Extraction of DNA from
R. oryzae
sporangiospores
in PBS by the manual method resulted in a level of detection
of 1
⫻
10
3sporangiospores (Table 1), whereas extraction by
the automated method resulted in a level of detection of 1
⫻
10
1sporangiospores (Table 1). In addition, significantly more
DNA (
P
ⱕ
0.008) was amplified at sporangiospore levels of
1
⫻
10
4,1
⫻
10
3, and 1
⫻
10
2with the automated method (Fig.
1C). When DNA was extracted from
R. oryzae
GHE, both
extraction methods resulted in a level of detection of 1
⫻
10
0GHE/ml (Table 1). At this level of detection, however, the
manual method demonstrated greater sensitivity in percent
yield of positive samples (
P
⫽
0.005) and recovered
signifi-cantly more DNA (
P
⫽
0.0006) (Fig. 1D).
Sample processing time.
The amount of time to process 24
samples by the automated method was 2.5 h for sample
col-lection, enzymatic pretreatment, and mechanical disruption
prior to transferring for automation. The time of automation
was 1.3 h by the MagNA Pure LC instrument followed by 10
min postautomation, resulting in a total time of 4 h. The
total time required for the manual method was 5.25 h, which
included sample collection, enzymatic pretreatment,
me-chanical disruption, and further processing with the DNeasy
Plant minikit.
DISCUSSION
The methods for DNA extraction from fungi for clinical
detection have long been ignored. Yet, the loss of as much as
99.9% of fungal DNA during the extraction process is a major
limitation to the analytical sensitivity of diagnostic PCR for
invasive apergillosis and other life-threatening mycoses.
Due to the limitations of the techniques currently used to
diagnose invasive pulmonary aspergillosis and invasive
pulmo-nary zygomycosis, there is a need for more sensitive,
non-culture-based techniques such as PCR. One parameter, which
influences the clinical usefulness of PCR, is the ability to
effi-ciently isolate DNA from a clinical sample. This paper
de-scribes two different DNA extraction methods that can be used
for
A. fumigatus
, the most common
Aspergillus
species causing
invasive pulmonary aspergillosis, and
R. oryzae
, an increasingly
important cause of zygomycosis. The data from this study
dem-onstrate that both methods are comparable. However, the
au-tomated method is faster and can be used for high-throughput
clinical laboratories. To our knowledge, this is the first study to
investigate these two medically important fungi for the
extrac-tion of DNA from BAL fluid using automated and manual
methods. Understanding these methods and their comparative
yields improves the use of these systems in clinical laboratories.
To date, there is no standardized PCR method for the
de-tection of fungal pathogens. The lack of standardization is due
in part to the uncertainty about the optimal sample (e.g.,
blood, serum, plasma, tissue, or BAL fluid) and inconsistency
between DNA extraction methods (6). There is a need for
more time-efficient automated DNA extraction methods for
fungi that may be standardized and that may decrease work
burden (6, 18). The ability to detect fungal pathogens in
clin-ical samples by qPCR requires extraction methods that can
efficiently lyse their cell walls.
The structure of the fungal cell wall is highly complex
com-pared to the structures of mammalian cell membranes and
bacterial cell walls (18). The fungal cell wall consists of
␣
- and
on May 16, 2020 by guest
http://jcm.asm.org/

-(1
3
3)-glucans,

-(1
3
6)-glucans, chitin, galactomannan,
mannans, mannoproteins, lipids, and peptides. Due to the
complexity of the fungal cell wall, conventional methods
em-ployed for extracting DNA from viruses and bacteria may not
be suitable for the extraction of DNA from these complex
organisms.
No single DNA extraction method is optimal for the efficient
extraction of all fungi. Therefore, in addition to some type of
enzymatic and or mechanical pretreatment, modifications of
kit protocols may be necessary (11, 18, 26). The manual DNA
extraction methods described in the literature for filamentous
fungi tend to be labor-intensive and time-consuming,
render-ing them unsuitable for high-throughput diagnostic
laborato-ries (8, 9, 11, 13, 18, 21, 22, 25, 26). When small numbers of
samples need to be processed, our laboratory uses the manual
DNA extraction method incorporating enzymatic
pretreat-ment and mechanical disruption with a modified version of the
DNeasy Plant minikit protocol (25, 26). The DNeasy Plant
minikit is a spin column procedure that incorporates sample
lysis, removal of RNA, removal of proteins and
polysaccha-rides, DNA precipitation, and binding to the spin column
membrane. Multiple washes are performed to remove
contam-inants, and DNA is then eluted from the membrane.
The automated or manual method may be suitable for DNA
FIG. 1. Amounts of DNA extracted by the automated and manual methods of DNA extraction. (A) Extraction of 10-fold serial dilutions of
Aspergillus fumigatus. a, not significant; b,
P
⫽
0.0003. (B) Extraction of
Aspergillus fumigatus
GHE in normal rabbit BAL fluid. a, not significant;
b,
P
ⱕ
0.008. (C) Extraction of 10-fold serial dilutions of
Rhizopus oryzae
sporangiospores. a, b, and c,
P
ⱕ
0.008. (D) Extraction of
Rhizopus oryzae
GHE in normal rabbit BAL fluid. The manual method extracted significantly more DNA (a,
P
⫽
0.0006) at a level of detection of 1
⫻
10
0GHE
than the automated method at the same level.
on May 16, 2020 by guest
http://jcm.asm.org/
extraction from BAL fluid containing mixed fungal elements of
A. fumigatus
or
R. oryzae
. Our data demonstrate that the
man-ual extraction method shows good correlation with the
auto-mated method. These data are in agreement with results
pre-sented by White et al. for the extraction of DNA from water or
EDTA-treated whole blood spiked with
A. fumigatus
conidia
(37).
The evolution of molecular diagnostics for mycology is
ad-vancing with the development of fully automated platforms
which have the ability to extract DNA from fungi (8, 13, 19,
21). We investigated the MagNA Pure LC instrument, a widely
used fully automated closed system, for DNA extraction. This
device can purify DNA from different biological samples
uti-lizing magnetic bead technology. Although MagNA Pure
tech-nology has been applied to blood and tissue for the detection
of yeasts and filamentous fungi, little has been known about
the comparative application of automated and manual
tech-nologies for detection of conidia and GHE of
Aspergillus
spp.
and
Rhizopus
spp. from lower respiratory tract specimens,
par-ticularly BAL fluid. BAL fluid was used in these studies
be-cause it is a common specimen chosen for analysis by clinical
microbiology laboratories for the detection of organisms in
patients with fungal pneumonia.
The automated and manual DNA extraction methods
de-scribed in this study effectively extracted DNA from
A.
fumiga-tus
and
R. oryzae
fungal propagules and GHE in BAL fluid.
Depending on the cellular stage of growth of the organism,
BAL fluid samples may contain a combination of GHE and
spores (2, 12). Our data demonstrate that both DNA
extrac-tion methods can efficiently extract DNA from
A. fumigatus
conidia at the same level of detection with no significant
dif-ference in sensitivity. In addition, no significant difdif-ference in
sensitivity was shown between DNA extraction methods when
extracting DNA from
A. fumigatus
GHE. Therefore, when
extracting BAL fluid samples that may contain diverse forms of
A. fumigatus
, either method could be implemented. When
ex-tracting DNA from
R. oryzae
sporangiospores, the automated
method demonstrated greater sensitivity in percent yield of
positive samples. The extraction of BAL fluid samples
contain-ing at least 10 GHE of
R
.
oryzae
with both the automated and
manual methods showed similar sensitivity. However, at the
lower limit of detection (1 GHE), the manual method showed
better sensitivity. Thus, either the automated or manual
method may be suitable for DNA extraction from BAL fluid
containing mixed fungal elements of
R. oryzae
.
In analyzing the data from these studies, a distinction was
made between sample sensitivity and absolute yield of DNA
per sample. The automated method resulted in similar or
greater quantities of DNA extracted for
Aspergillus
and
Rhizo-pus
propagules and
Aspergillus
GHE. Greater quantities of
DNA may be extracted from these types of samples using the
automated method because unlike the manual method,
follow-ing enzymatic treatment, the automated method does not
in-corporate a centrifugation step and subsequent removal of
supernatant. Hence, the entire sample is carried through the
automated extraction method. The centrifugation step and
re-moval of supernatant in the manual method may result in the
loss of organism and therefore the isolation of less DNA using
the manual method.
[image:5.585.42.282.90.402.2]The manual method resulted in similar or greater quantities
of DNA extracted for
Rhizopus
GHE. There may be several
factors contributing to these differences. By visual inspection
with an inverted microscope, the hyphal elements of
A.
fumiga-tus
were narrow, septate, and dichotomously branched with
uniform diameter, whereas the
R. oryzae
hyphal elements were
broad, bulky, and sparsely septate with nonparallel irregular
branching. Therefore, when
R. oryzae
GHE were processed,
there likely would have been denser cellular debris in these
samples. The manual method incorporates a filtration and
homogenization unit designed to help remove cellular debris
and precipitates, which may interfere with efficient DNA
iso-lation from zygomycetes such as
Rhizopus
spp. By comparison,
the automated method does not include a filtration and
ho-mogenization unit for the removal of cellular debris and
pre-cipitates. Therefore, any cellular debris not removed by the
repeated washing of the magnetic glass particles used in the
automated method may reduce the efficiency of isolation. At
the lower level of detection there may be such a small amount
of DNA extracted that any cellular debris may have affected
the ability of the DNA to bind to the magnetic glass particles,
resulting in the isolation of less DNA by the automated
method. Conversely, at the higher cellular concentrations there
may be so much DNA that the cellular debris has a minimal
effect on the amount of DNA obtained.
TABLE 1. Sensitivity of DNA extraction methods for
Aspergillus fumigatus
and
Rhizopus oryzae
Isolate and amt % Sensitivity (n
a
)
Automated method Manual method
A. fumigatus
Conidia
1
⫻
10
4100 (8)
100 (7)
1
⫻
10
3100 (8)
86 (7)
1
⫻
10
238
b(8)
17
b(6)
1
⫻
10
10 (8)
0 (6)
1
⫻
10
00 (8)
0 (6)
GHE
1
⫻
10
4100 (9)
100 (9)
1
⫻
10
3100 (9)
100 (9)
1
⫻
10
2100 (9)
100 (9)
1
⫻
10
1100 (9)
89 (9)
1
⫻
10
0100
c(9)
56
c(9)
R. oryzae
Sporangiospores
1
⫻
10
4100 (6)
100 (6)
1
⫻
10
3100
e(7)
17
e(6)
1
⫻
10
2100
d(6)
0
d(6)
1
⫻
10
117 (6)
0 (6)
1
⫻
10
00 (6)
0 (6)
GHE
1
⫻
10
4100 (7)
100 (7)
1
⫻
10
3100 (7)
100 (7)
1
⫻
10
2100 (7)
100 (7)
1
⫻
10
1100 (7)
100 (7)
1
⫻
10
014
e(7)
100
e(7)
aNo. of samples processed.
bP⫽0.58.
cP⫽0.08.
dP⫽0.002.
eP⫽0.005.
on May 16, 2020 by guest
http://jcm.asm.org/
Even with the implementation of the enzymatic
pretreat-ment and mechanical disruption, the automated method was
still 1.25 h faster than the manual method when extracting 24
samples. For this reason, the automated method is an
encour-aging option for high-throughput laboratories with a need to
extract DNA from filamentous fungi in multiple clinical
sam-ples. The manual method remains a useful option when small
numbers of samples need to be processed.
The MagNA Pure technology reduces the number of manual
steps needed for DNA extraction from various types of
sam-ples. However, when using it to extract DNA from fungi,
ad-ditional manual steps need to be incorporated. This instrument
can extract up to 32 samples at one time, therefore making it
more time-efficient than manual methods. The automated
method has been implemented in our laboratory for
high-throughput extraction of in vivo samples. As we transfer our
PCR technology for detection of
Aspergillus
and zygomycetes
to the clinical laboratory, the manual method of extraction will
be incorporated for the relatively small number of BAL fluid
samples submitted daily.
These data provide a foundation for the use of either an
automated or manual method of DNA extraction of BAL fluid
samples from immunocompromised patients for whom a
diag-nosis of pulmonary aspergillosis or zygomycosis is being
con-sidered. The automated method is more time-efficient when
extracting 24 samples and demonstrates equal or greater levels
of detection. The automated DNA extraction method may
provide a favorable option for high-throughput clinical
labo-ratories. The manual method is useful if small numbers of
samples need to be processed.
REFERENCES
1.Alangaden, G. J., M. Wahiduzzaman, and P. H. Chandrasekar.2002. As-pergillosis: the most common community-acquired pneumonia with gram-negative Bacilli as copathogens in stem cell transplant recipients with
graft-versus-host disease. Clin. Infect. Dis.35:659–664.
2.Bauters, T. G., and H. J. Nelis.2000. Rapid and sensitive plate method for
detection ofAspergillus fumigatus. J. Clin. Microbiol.38:3796–3799.
3.Benjamin, D. K., Jr., W. C. Miller, S. Bayliff, L. Martel, K. A. Alexander, and P. L. Martin.2002. Infections diagnosed in the first year after pediatric stem
cell transplantation. Pediatr. Infect. Dis. J.21:227–234.
4.Bretagne, S., and J. M. Costa. 2005. Towards a molecular diagnosis of invasive aspergillosis and disseminated candidosis. FEMS Immunol. Med.
Microbiol.45:361–368.
5.Buchheidt, D., C. Baust, H. Skladny, J. Ritter, T. Suedhoff, M. Baldus, W. Seifarth, C. Leib-Moesch, and R. Hehlmann.2001. Detection of Aspergillus species in blood and bronchoalveolar lavage samples from immunocompro-mised patients by means of 2-step polymerase chain reaction: clinical results.
Clin. Infect. Dis.33:428–435.
6.Chen, S. C., C. L. Halliday, and W. Meyer.2002. A review of nucleic acid-based diagnostic tests for systemic mycoses with an emphasis on
poly-merase chain reaction-based assays. Med. Mycol.40:333–357.
7.Cornet, M., L. Fleury, C. Maslo, J. F. Bernard, and G. Brucker.2002. Epidemiology of invasive aspergillosis in France: a six-year multicentric
survey in the Greater Paris area. J. Hosp. Infect.51:288–296.
8.Costa, C., J. M. Costa, C. Desterke, F. Botterel, C. Cordonnier, and S. Bretagne.2002. Real-time PCR coupled with automated DNA extraction and detection of galactomannan antigen in serum by enzyme-linked immu-nosorbent assay for diagnosis of invasive aspergillosis. J. Clin. Microbiol.
40:2224–2227.
9.Faggi, E., G. Pini, and E. Campisi.2005. Use of magnetic beads to extract
fungal DNA. Mycoses48:3–7.
10.Francesconi, A., M. Kasai, R. Petraitiene, V. Petraitis, A. M. Kelaher, R. Schaufele, W. W. Hope, Y. R. Shea, J. Bacher, and T. J. Walsh.2006. Characterization and comparison of galactomannan enzyme immunoassay
and quantitative real-time PCR assay for detection ofAspergillus fumigatusin
bronchoalveolar lavage fluid from experimental invasive pulmonary
aspergil-losis. J. Clin. Microbiol.44:2475–2480.
11.Fredricks, D. N., C. Smith, and A. Meier.2005. Comparison of six DNA extraction methods for recovery of fungal DNA as assessed by quantitative
PCR. J. Clin. Microbiol.43:5122–5128.
12.Glazer, M., S. Nusair, R. Breuer, J. Lafair, Y. Sherman, and N. Berkman.
2000. The role of BAL in the diagnosis of pulmonary mucormycosis. Chest
117:279–282.
13.Griffiths, L. J., M. Anyim, S. R. Doffman, M. Wilks, M. R. Millar, and S. G. Agrawal.2006. Comparison of DNA extraction methods for Aspergillus
fumigatus using real-time PCR. J. Med. Microbiol.55:1187–1191.
14.Grow, W. B., J. S. Moreb, D. Roque, K. Manion, H. Leather, V. Reddy, S. A. Khan, K. J. Finiewicz, H. Nguyen, C. J. Clancy, P. S. Mehta, and J. R. Wingard.2002. Late onset of invasive aspergillus infection in bone marrow
transplant patients at a university hospital. Bone Marrow Transplant.29:
15–19.
15.Hope, W. W., T. J. Walsh, and D. W. Denning.2005. Laboratory diagnosis of
invasive aspergillosis. Lancet Infect. Dis.5:609–622.
16.Horger, M., H. Hebart, H. Schimmel, M. Vogel, H. Brodoefel, K. Oechsle, U. Hahn, M. Mittelbronn, W. Bethge, and C. D. Claussen.2006. Disseminated mucormycosis in haematological patients: CT and MRI findings with
patho-logical correlation. Br. J. Radiol.79:e88–95.
17.Husain, S., B. D. Alexander, P. Munoz, R. K. Avery, S. Houston, T. Pruett, R. Jacobs, E. A. Dominguez, J. G. Tollemar, K. Baumgarten, C. M. Yu, M. M. Wagener, P. Linden, S. Kusne, and N. Singh.2003. Opportunistic mycelial fungal infections in organ transplant recipients: emerging
impor-tance of non-Aspergillus mycelial fungi. Clin. Infect. Dis.37:221–229.
18.Karakousis, A., L. Tan, D. Ellis, H. Alexiou, and P. J. Wormald.2006. An assessment of the efficiency of fungal DNA extraction methods for maximiz-ing the detection of medically important fungi usmaximiz-ing PCR. J. Microbiol.
Methods65:38–48.
19.Klingspor, L., and S. Jalal.2006. Molecular detection and identification of Candida and Aspergillus spp. from clinical samples using real-time PCR.
Clin. Microbiol. Infect.12:745–753.
20.Kontoyiannis, D. P., M. S. Lionakis, R. E. Lewis, G. Chamilos, M. Healy, C. Perego, A. Safdar, H. Kantarjian, R. Champlin, T. J. Walsh, and Raad, I. I.
2005. Zygomycosis in a tertiary-care cancer center in the era of Aspergillus-active antifungal therapy: a case-control observational study of 27 recent
cases. J. Infect. Dis.191:1350–1360.
21.Loeffler, J., K. Schmidt, H. Hebart, U. Schumacher, and H. Einsele.2002. Automated extraction of genomic DNA from medically important yeast species and filamentous fungi by using the MagNA Pure LC system. J. Clin.
Microbiol.40:2240–2243.
22.Loffler, J., H. Hebart, U. Schumacher, H. Reitze, and H. Einsele.1997. Comparison of different methods for extraction of DNA of fungal pathogens
from cultures and blood. J. Clin. Microbiol.35:3311–3312.
23.Marr, K. A., R. A. Carter, M. Boeckh, P. Martin, and L. Corey.2002. Invasive aspergillosis in allogeneic stem cell transplant recipients: changes in
epidemiology and risk factors. Blood100:4358–4366.
24.Morgan, J., K. A. Wannemuehler, K. A. Marr, S. Hadley, D. P. Kontoyiannis, T. J. Walsh, S. K. Fridkin, P. G. Pappas, and D. W. Warnock.2005. Inci-dence of invasive aspergillosis following hematopoietic stem cell and solid organ transplantation: interim results of a prospective multicenter
surveil-lance program. Med. Mycol.43(Suppl. 1):S49–S58.
25.Muller, F. M., K. E. Werner, M. Kasai, A. Francesconi, S. J. Chanock, and T. J. Walsh.1998. Rapid extraction of genomic DNA from medically impor-tant yeasts and filamentous fungi by high-speed cell disruption. J. Clin.
Microbiol.36:1625–1629.
26.O’Sullivan, C. E., M. Kasai, A. Francesconi, V. Petraitis, R. Petraitiene, A. M. Kelaher, A. A. Sarafandi, and T. J. Walsh.2003. Development and validation of a quantitative real-time PCR assay using fluorescence
reso-nance energy transfer technology for detection ofAspergillus fumigatusin
experimental invasive pulmonary aspergillosis. J. Clin. Microbiol.41:5676–
5682.
27.Pagano, L., P. Ricci, A. Tonso, A. Nosari, L. Cudillo, M. Montillo, A. Cenacchi, L. Pacilli, F. Fabbiano, A. Del Favero, et al.1997. Mucormycosis in patients with haematological malignancies: a retrospective clinical study of
37 cases. Br. J. Haematol.99:331–336.
28.Paterson, D. L., and N. Singh. 1999. Invasive aspergillosis in transplant
recipients. Medicine (Baltimore)78:123–138.
29.Patterson, T. F., W. R. Kirkpatrick, M. White, J. W. Hiemenz, J. R. Wingard, B. Dupont, M. G. Rinaldi, D. A. Stevens, J. R. Graybill, et al.2000. Invasive aspergillosis. Disease spectrum, treatment practices, and outcomes.
Medi-cine (Baltimore)79:250–260.
30.Petraitiene, R., V. Petraitis, A. H. Groll, T. Sein, R. L. Schaufele, A. Francesconi, J. Bacher, N. A. Avila, and T. J. Walsh. 2002. Antifungal efficacy of caspofungin (MK-0991) in experimental pulmonary aspergillosis in persistently neutropenic rabbits: pharmacokinetics, drug disposition, and relationship to galactomannan antigenemia. Antimicrob. Agents
Che-mother.46:12–23.
31.Rementeria, A., N. Lopez-Molina, A. Ludwig, A. B. Vivanco, J. Bikandi, J. Ponton, and J. Garaizar.2005. Genes and molecules involved in Aspergillus
fumigatus virulence. Rev. Iberoam Micol.22:1–23.
32.Roden, M. M., T. E. Zaoutis, W. L. Buchanan, T. A. Knudsen, T. A. Sarkisova, R. L. Schaufele, M. Sein, T. Sein, C. C. Chiou, J. H. Chu, D. P. Kontoyiannis, and T. J. Walsh.2005. Epidemiology and outcome of
zygo-mycosis: a review of 929 reported cases. Clin. Infect. Dis.41:634–653.
on May 16, 2020 by guest
http://jcm.asm.org/
33.Saito, H., E. J. Anaissie, R. C. Morice, R. Dekmezian, and G. P. Bodey.1988. Bronchoalveolar lavage in the diagnosis of pulmonary infiltrates in patients
with acute leukemia. Chest94:745–749.
34.Siwek, G. T., K. J. Dodgson, M. de Magalhaes-Silverman, L. A. Bartelt, S. B. Kilborn, P. L. Hoth, D. J. Diekema, and M. A. Pfaller.2004. Invasive zygomycosis in hematopoietic stem cell transplant recipients receiving
vori-conazole prophylaxis. Clin. Infect. Dis.39:584–587.
35.Stergiopoulou, T., J. Meletiadis, E. Roilides, D. E. Kleiner, R. Schaufele, M. Roden, S. Harrington, L. Dad, B. Segal, and T. J. Walsh. 2007. Host-dependent patterns of tissue injury in invasive pulmonary aspergillosis.
Am. J. Clin. Pathol.127:349–355.
36.Tarrand, J. J., M. Lichterfeld, I. Warraich, M. Luna, X. Y. Han, G. S. May,
and D. P. Kontoyiannis.2003. Diagnosis of invasive septate mold infections. A correlation of microbiological culture and histologic or cytologic
exami-nation. Am. J. Clin. Pathol.119:854–858.
37.White, P. L., R. Barton, M. Guiver, C. J. Linton, S. Wilson, M. Smith, B. L. Gomez, M. J. Carr, P. T. Kimmitt, S. Seaton, K. Rajakumar, T. Holyoake, C. C. Kibbler, E. Johnson, R. P. Hobson, B. Jones, and R. A. Barnes.2006. A consensus on fungal polymerase chain reaction diagno-sis? A United Kingdom-Ireland evaluation of polymerase chain reaction
methods for detection of systemic fungal infections. J. Mol. Diagn.8:376–
384.
38.Zmeili, O. S., and A. O. Soubani.2007. Pulmonary aspergillosis: a clinical
update. Q. J. Med.100:317–334.
