• No results found

biological sequence dynamic alignment

Acceleration of Algorithm of Smith Waterman Using Recursive Variable Expansion

Acceleration of Algorithm of Smith Waterman Using Recursive Variable Expansion

... Abstract— Biological sequence alignment is becoming popular and interesting field to researchers especially the ...any alignment algorithm like Smith-Waterman Algorithm (SWA), Needleman-Wunsch ...

6

Dynamic Smith Waterman Algorithm: A High Performance Grid Enabled Application Integrated with Globus, GridSphere Portal Framework and CoG Workflow for Performing Biological Local Sequence Alignment

Dynamic Smith Waterman Algorithm: A High Performance Grid Enabled Application Integrated with Globus, GridSphere Portal Framework and CoG Workflow for Performing Biological Local Sequence Alignment

... The Dynamic Smith-Waterman relies on the availability of such application-specific information from Application Performance Database (AppDB) from the Application Information Services (AIS) [28] where runtime ...

8

A novel genetic approach for optimized biological sequence alignment

A novel genetic approach for optimized biological sequence alignment

... pairwise sequence alignment methods are used to find the best local or global alignments of two se- ...quences. Dynamic programming is a method that de- termines optimal alignment by matching ...

5

Adopting Biological Sequence Alignment Tools in 2D Shape Recognition

Adopting Biological Sequence Alignment Tools in 2D Shape Recognition

... ways sequence alignment ...of dynamic programmingto relate biological ...whole sequence) into a sequence of smaller problems and uses the answers to the smaller problems to ...

7

Optimization of Process Parameters of Global Sequence Alignment Based Dynamic Program   an Approach to Enhance the Sensitivity of Alignment

Optimization of Process Parameters of Global Sequence Alignment Based Dynamic Program an Approach to Enhance the Sensitivity of Alignment

... of biological sequence databases grow exponentially, the need for fast and efficient sequence alignment algorithms is ...efficient alignment algorithms. Needleman and Wunsch proposed a ...

6

DNA Sequence alignment using programme by algorithm

DNA Sequence alignment using programme by algorithm

... standard dynamic programming, the ion is independent of the identity base stacking effects are not taken into ...an alignment is usually reduced and residues and gaps are kept together, which typically ...

5

Molecular Characterization and Phylogenetic Analysis of Culex quinquefasciatus by DNA Barcoding

Molecular Characterization and Phylogenetic Analysis of Culex quinquefasciatus by DNA Barcoding

... Culex quinquefasciatus, a mosquito that belongs to the phylum Arthopoda, is an important factor causing filariasis [1], St. Louis encephalitis [2], West Nile virus [3] and Avion malaria [4]. Culex quinquefasciatus, also ...

7

Insights of Rv2921c (Ftsy) Gene of Mycobacterium
tuberculosis H37Rv To Prove Its Significance by
Computational Approach

Insights of Rv2921c (Ftsy) Gene of Mycobacterium tuberculosis H37Rv To Prove Its Significance by Computational Approach

... prearranged sequence of protein and assembles the 3D model of protein by Ab Initio display ...desired dynamic binding sites of our selected protein were anticipated by COACH online ...to dynamic ...

11

Optimization of sequence alignment for simple sequence repeat regions

Optimization of sequence alignment for simple sequence repeat regions

... Five different sequences (Table 1) of SSR motifs obtained from a biotechnology laboratory (Genetic Resources Section, ICARDA), were used in this research. These sequences were obtained from 26 plants repre- senting 26 ...

9

Integration of Clustering and Multidimensional Scaling to Determine Phylogenetic Trees as Spherical Phylogram Visualized in 3 Dimensions

Integration of Clustering and Multidimensional Scaling to Determine Phylogenetic Trees as Spherical Phylogram Visualized in 3 Dimensions

... Pairwise Sequence Alignment Distance Calculation Multidimensional Scaling Interpolation DACIDR Traditional Phylogenetic Tree Construction... Pairwise Sequence Alignment PWA • Finds an ov[r] ...

27

HAlign-II: efficient ultra-large multiple sequence alignment and phylogenetic tree reconstruction with distributed and parallel computing

HAlign-II: efficient ultra-large multiple sequence alignment and phylogenetic tree reconstruction with distributed and parallel computing

... star sequence for pairwise alignment and to integrate inserted ...star sequence contains the most segments among all sequences, thereby implying that it is the most similar to other ...first ...

10

Figure S1. Sequence alignment of RBP proteins head domains. A. Sequence alignment of the RBP

Figure S1. Sequence alignment of RBP proteins head domains. A. Sequence alignment of the RBP

... ATGGGAGTTAGCAAAGGTGAAGAACTGTTTACGGGCGTTGTGCCGATCCTGGTGGAACTGGACGGTGA TGTTAATGGTCATAAATTCTCTGTGAGTGGCGAAGGTGAAGGCGATGCGACCTATGGTAAACTGACGC TGAAATTTATTTGCACCACCGGTAAACTGCCGGTTCCGTGGCCGACCC[r] ...

15

Wei, Tiandi
  

(2010):


	Homology Modeling of Toll-Like Receptor Ligand-Binding Domains: A Leucine-Rich Repeat Assembly Approach.


Dissertation, LMU München: Fakultät für Geowissenschaften

Wei, Tiandi (2010): Homology Modeling of Toll-Like Receptor Ligand-Binding Domains: A Leucine-Rich Repeat Assembly Approach. Dissertation, LMU München: Fakultät für Geowissenschaften

... enough sequence identity to the target repetitive protein (single template modeling), due to different repeat numbers and varying ...target sequence as a local ...multiple sequence alignments for the ...

117

Effect of positional dependence and alignment strategy on modeling transcription factor binding sites

Effect of positional dependence and alignment strategy on modeling transcription factor binding sites

... the probability that the known negative example would score higher than the known positive example — produc- ing a false positive. PS scopes larger than a certain value do not capture any new position-pair matches, yet ...

11

Evaluating Sequence Alignment for Learning Inflectional Morphology

Evaluating Sequence Alignment for Learning Inflectional Morphology

... high level of accuracy, creating them is difficult and requires a great deal of engineering overhead. Recently, more automatic, machine learning methods have been utilized. These systems have required far less ...

5

Sequence embedding for fast construction of guide trees for multiple sequence alignment

Sequence embedding for fast construction of guide trees for multiple sequence alignment

... worse that using the default guide trees. The bad news is that all guide trees are ineffective anyway. For the remain- ing four test cases, the randomised Clustal guide trees are clearly inferior to both the default ...

11

Conserved antigenic sites between MERS-CoV and Bat-coronavirus are revealed through sequence analysis

Conserved antigenic sites between MERS-CoV and Bat-coronavirus are revealed through sequence analysis

... marked sequence divergence in the spike protein of pipistrellus bat coronavirus HKU5 in Japanese pipistrelle: implications for the origin of the novel Middle East respiratory syndrome ...

6

Horizontal transfer and proliferation of Tsu4 in Saccharomyces paradoxus

Horizontal transfer and proliferation of Tsu4 in Saccharomyces paradoxus

... Within S. paradoxus, the deepest well-supported branches in the S. paradoxus Tsu4 clade are between N. American/Hawaiian and S. American S. paradoxus lin- eages, suggesting the HTT event predates separation of these ...

8

Heuristics for multiobjective multiple sequence alignment

Heuristics for multiobjective multiple sequence alignment

... Multiple sequence alignment (MSA) is of central importance to ...analyse biological sequences and to design applications in structure mod- eling, functional prediction, phylogenetic analysis and ...

17

A RANDOMIZED ALGORITHM FOR FAST SEQUENCE ALIGNMENT

A RANDOMIZED ALGORITHM FOR FAST SEQUENCE ALIGNMENT

... The algorithm begins by shuffling the given input sequences using the Durstenfeld-Fisher-Yates shuffle [8] algorithm, aligning each configuration, evaluating the alignment score for that particular combination, ...

5

Show all 10000 documents...

Related subjects