HIV-1 strain diversity
Extensive Recombination among Human Immunodeficiency Virus Type 1 Quasispecies Makes an Important Contribution to Viral Diversity in Individual Patients
... 11 HIV-1 subtype B sequences from the Los Alamos database was used to identify regions in gag, protease, RT, and env which met the following criteria: (i) all were coding regions, (ii) insertions and ...
11
Universal Amplification, Next Generation Sequencing, and Assembly of HIV 1 Genomes
... Genetic diversity of HIV-1 genes, groups, and ...representative HIV-1 genomes sequenced in this study are shown in a circular ...reference strain HXB2 (GenBank accession number ...
7
Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses.
... for HIV infection largely explains viral tropism at the level of entry into the ...major HIV-1 coreceptors, the possibility exists that other chemokine receptors or related molecules influence viral ...
9
Constraints on HIV-1 Diversity from Protein Structure
... FIG. 1. Genetic distances and sequence variability of HIV-1 gag and env subtype B and C sequences through ...of HIV-1 group M gag subtype B (A), gag subtype C (C), env subtype B (E), ...
9
Diversity of the Human Immunodeficiency Virus Type 1 (HIV-1) env Sequence after Vertical Transmission in Mother-Child Pairs Infected with HIV-1 Subtype A
... Selection might also act posttransmission, i.e., there would be transmission of multiple variants and a quick outgrowth of the strain with the highest fitness. Since we analyzed proviral DNA in the early phase of ...
8
HIV-1 genetic diversity and its distribution characteristics among newly diagnosed HIV-1 individuals in Hebei province, China
... six HIV-1 subtypes were identified successfully, including subtype B ...CRF01_AE/B. HIV-1 genotype distribution showed a significant statistical difference in different demographic ...
12
Impact of Human Immunodeficiency Virus Type 1 (HIV 1) Genetic Diversity on Performance of Four Commercial Viral Load Assays: LCx HIV RNA Quantitative, AMPLICOR HIV 1 MONITOR v1 5, VERSANT HIV 1 RNA 3 0, and NucliSens HIV 1 QT
... Ninety-seven HIV-1-se- ropositive plasma samples collected in Cameroon (n ⫽ 47), South Africa (n ⫽ 29), and Brazil (n ⫽ 21) were utilized for this ...Table 1, the panel was composed of 95 ...
9
HIV 1 genotype diversity and distribution characteristics among heterosexually transmitted population in Jiangsu province, China
... in HIV transmission patterns. In Jiangsu between 1991 and 1998, HIV-1 infection was initially con- fined to IDUs, FPDs and recipients of blood ...However, HIV-1 infection cases ...
9
HIV-1 Subtype distribution in morocco based on national sentinel surveillance data 2004-2005
... all HIV positive specimens from the 2004-2005 survey, the sample size was relatively ...the HIV-infected individuals were not available for this study, since they are not required in the surveillance ...the ...
8
Single genome analysis reveals genetic characteristics of Neuroadaptation across HIV 1 envelope
... significant HIV-1 env compartmentalization between the CSF and plasma in a subset of individuals across neurocognitive disease states and cART ...mean HIV-1 env diversity was statisti- ...
22
Porphyromonas gingivalis Strain Diversity
... test strain genomes was first confirmed by ...test strain genomes, as determined by PCR—which suggests diver- gence at the primer(s) binding site(s)—was further verified by Southern blot ...control ...
9
Xenorhabdus bovienii Strain Diversity Impacts Coevolution and Symbiotic Maintenance with Steinernema spp Nematode Hosts
... Experimental testing of mutualistic interactions. As an ex- perimental test of specificity and coevolution, we examined the ability of nematode-bacterium pairs to engage in mutualism through experimental coinjections of ...
10
Index Catalog // Carolina Digital Repository
... that HIV can at least pass through layers of the trophoblast cells that line the placental barrier in vitro, and that chroioamnionitis increases transmission ...
124
Experimental Adaptive Evolution of Simian Immunodeficiency Virus SIVcpz to Pandemic Human Immunodeficiency Virus Type 1 by Using a Humanized Mouse Model
... or HIV-1M NL4-3 Vif (as a positive control) were cotransfected with pNL4-3Δvif and either APOBEC3F or APOBEC3G expression plasmids into HEK293T ...of HIV-1 clade C strain ...
21
HIV evolution and diversity in ART treated patients
... When HIV infected cells proliferate, proviral sequences are replicated with the high-fidelity cellu- lar DNA polymerase, resulting in identical copies of the original ...investigate HIV integration sites ...
12
Efficient Vpu-Mediated Tetherin Antagonism by an HIV-1 Group O Strain
... pandemic HIV-1 group M strains evolved Vpu as a tetherin an- tagonist, while the Nef protein of less widespread HIV-1 group O strains acquired the ability to target a region adjacent to this ...
20
Persistent nonproductive infection of Epstein-Barr virus-transformed human B lymphocytes by human immunodeficiency virus type 1.
... This evolution from HIV-1 production to low-level cell-associated behavior appeared to be specific to the IIIB strain; other HIV-1 strains which replicate in the X50-7 and X50-7.8 cells [r] ...
13
Characterization of HIV 1 gag and nef in Cameroon: further evidence of extreme diversity at the origin of the HIV 1 group M epidemic
... The phylogenetic analysis of gag sequences derived from the Cameroonian samples further revealed four sequences (BS09, BS25, BS16 and BS42) situated on di- vergent branches near the base of the CRF02_AG sub- tree, ...
7
The V86M mutation in HIV 1 capsid confers resistance to TRIM5α by abrogation of cyclophilin A dependent restriction and enhancement of viral nuclear import
... The primer sets to detect each DNA species were as follows: GFP forward, GACGACGGCAACTACAAGAC; GFP reverse, TCGTCCATGCCGAGAGTGAT; 2LTR- circles forward (MH535), AACTAGGGAACCCACTG CTTAAG [66]; 2LTR-circles reverse ...
14
Factors Leading to the Loss of Natural Elite Control of HIV-1 Infection
... Spanish HIV HGM BioBank, which is supported by the Spanish Instituto de Salud Carlos III (RETIC PT13/001/0028) and is integrated in the Spanish AIDS Research Network ...
18