• No results found

Primer sequences used for amplification of the

Assessing alternative base substitutions at primer CpG sites to optimise unbiased PCR amplification of methylated sequences

Assessing alternative base substitutions at primer CpG sites to optimise unbiased PCR amplification of methylated sequences

... genome amplification twice in succession on normal peripheral blood DNA [5, ...V2 amplification kit (GE Healthcare, Little Chalfont, UK) using the manufacturer’s ...was used as the fully methylated ...

9

Detection of an amplification bias associated to Leuconostocaceae family with a universal primer routinely used for monitoring microbial community structures within food products

Detection of an amplification bias associated to Leuconostocaceae family with a universal primer routinely used for monitoring microbial community structures within food products

... The relative bacterial composition within Leuconos- tocaceae of our chosen food samples and mock com- munities is detailed in Fig. 1. Less than 0.5% of sequence of Leuconostoc was detected within the samples ampli- fied ...

5

Amplification of human papillomavirus DNA sequences by using conserved primers

Amplification of human papillomavirus DNA sequences by using conserved primers

... Use of primers derived from sequences shared by different virus types for PCR amplification of papillomavirus DNA se- quences could be of value for the identification of viral.. sequence[r] ...

6

Rapid and Simple Amplification of Genomic DNA Sequences Flanking Transposon

Rapid and Simple Amplification of Genomic DNA Sequences Flanking Transposon

... rapid amplification of regions of unknown sequence flanking specified segments of ...known sequences, the inverse PCR approach is not amenable to proceeding very long distances in the ...DNA ...

5

Classroom Amplification Technology has been used effectively to

Classroom Amplification Technology has been used effectively to

... Infrared classroom amplification systems may be installed or portable. They contain similar system components and operate in much the same manner. The teacher wears a lightweight wireless microphone that trans- ...

10

Specific Amplification of Ribosomal Sequences Using Comultiplex Polymerase Chain Reaction

Specific Amplification of Ribosomal Sequences Using Comultiplex Polymerase Chain Reaction

... Amplification of DNA sequences from ribosomal DNA (rDNA) was tested as a specific and sensitive method for the detection of small numbers of Toxoplasma gondii tachyzoite cells.. We appli[r] ...

5

Supplementary Table 1: Primer pair sequences for the analyses of gene expression.

Supplementary Table 1: Primer pair sequences for the analyses of gene expression.

... 1: Primer pair sequences for the analyses of gene ...Gene Primer pairs Reference Cycling conditions Actb fw 5' AGCTGCGTTTTACACCCTTT 3' rv 5' AAGCCATGCCAATGTTGTCT 3' [Cardoso et ...

6

Tab1e 1 Sequences of primers for target genes of amplified fragment. Gene Primer Sequences 5-3 CGTTCGACAAGGGTGACTAT TCGATTGCCACCAAAAGTGC

Tab1e 1 Sequences of primers for target genes of amplified fragment. Gene Primer Sequences 5-3 CGTTCGACAAGGGTGACTAT TCGATTGCCACCAAAAGTGC

... Human Epidermal Melanocyte (PIG1) cells were exposed to UVB at doses ranging from 50 to 90mJ/cm 2 to measure melanin content with the NaOH method.. The tyrosinase activity of Human[r] ...

14

Rapid and sensitive detection of Mycobacterium leprae using a nested primer gene amplification assay

Rapid and sensitive detection of Mycobacterium leprae using a nested primer gene amplification assay

... portion of the target genome and two inside primers that will direct the amplification of sequences contained within the product defined and produced by the outside primers (for a.. revi[r] ...

5

Universal Primer Set for Amplification and Sequencing of HA0 Cleavage Sites of All Influenza A Viruses

Universal Primer Set for Amplification and Sequencing of HA0 Cleavage Sites of All Influenza A Viruses

... the sequences published in EMBL, GenBank, and DDBJ, and all were found to have 100% iden- ...utilizing primer mixes to provide sequencing primers which have different melting temperatures and nonviral tails ...

7

Intercistronic as well as terminal sequences are required for efficient amplification of brome mosaic virus RNA3.

Intercistronic as well as terminal sequences are required for efficient amplification of brome mosaic virus RNA3.

... Preliminary results from a finer-scale deletion mapping of sequences extending into the 5' noncoding region show that RNA3 accumulation is unaffected until deletions enter the noncoding [r] ...

9

Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.

Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection.

... We report here the application of recently developed nucleic acid amplification and oligonucleotide- based detection procedures for the identification of HIV sequences in established inf[r] ...

5

PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species

PCR amplification and comparison of nucleotide sequences from the groESL heat shock operon of Ehrlichia species

... The spacer region should make a good target for species- specific probes. Use of a sensitive hybridization detection method might eliminate the need for nested PCR, since am- plicon contamination is more of a concern by ...

6

Detection of Influenza A Viruses from Different Species by PCR Amplification of Conserved Sequences in the Matrix Gene

Detection of Influenza A Viruses from Different Species by PCR Amplification of Conserved Sequences in the Matrix Gene

... National Influenza Center and Department of Virology, Erasmus University, Rotterdam, The Netherlands Received 11 May 2000/Returned for modification 27 July 2000/Accepted 5 September 2000 The recently raised awareness of ...

6

Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus

Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus

... Long-term culture results in reversion of SD2 viruses. To investigate the possibility of reversion, we cultured the infected cells over longer periods and did not find any sign of reversion of the SD and SD3 constructs ...

7

Amplification of Bacterial DNA Using Highly Conserved Sequences: Automated Analysis and Potential for Molecular Triage of Sepsis

Amplification of Bacterial DNA Using Highly Conserved Sequences: Automated Analysis and Potential for Molecular Triage of Sepsis

... Aquaspirillum magnetotacticum using polymerase chain reaction- amplified 165 rRNA-specific DNA. Relman DA, Schmidt TM, MacDermott RP, Falkow S. Identification of the uncultured bacillus [r] ...

7

Bandwidth Primer The basic conditions and terms used to describe information exchange over networks.

Bandwidth Primer The basic conditions and terms used to describe information exchange over networks.

... A Primer on Bandwidth Bandwidth refers to the amount of information that can be transmitted over a network in a given amount of time, usually expressed in kilobits (thousands of bits) per second or ...

10

Identification of Potential Methylation Regions of the Smad4 mRNA and Determining Primer Sequences for  MS-PCR with the ‘Methprimer’ Program

Identification of Potential Methylation Regions of the Smad4 mRNA and Determining Primer Sequences for MS-PCR with the ‘Methprimer’ Program

... bisulphite sequences for these regions and designing relevant primer sequences of SMAD4 for reverse transcriptase ...We used the ‘MethPrimer’ program in the present ...

5

The effect of primer choice and short read sequences on the outcome of 16S rRNA gene based diversity studies

The effect of primer choice and short read sequences on the outcome of 16S rRNA gene based diversity studies

... of primer choice on the outcome of short read sequencing ...i.e. primer coverage rate, phylogeny, OTU-richness and taxonomic assignment, were therefore implemented in one study for ten well established ...

14

Amplification/PCR. Amplification Software 303

Amplification/PCR. Amplification Software 303

... For More Information Web: www.bio-rad.com/sealers Chill-out liquid wax provides an excellent vapor barrier that may be used instead of mineral oil in thermal cyclers without heated lids. After cycling, the tubes ...

34

Show all 10000 documents...

Related subjects