Primer sequences used for ERV3 quantitation:
ERV3 and Related Sequences in Humans: Structure and RNA Expression
... was used in each ...was used according to the manufacturer ⬘ s recommendations (Merck Eurolab, Stock- holm, ...was used for cDNA synthesis, which was performed as described above in a 50- l ...
15
Fragmentation of DNA affects the accuracy of the DNA quantitation by the commonly used methods
... fragmentation in a fashion similar to PG. Smaller frag- ments resulted in lower concentrations measured. There was one exception to this observation, when the unfrag- mented specimens had lower concentrations measured in ...
8
Ultrasensitive quantitation of human papillomavirus type 16 E6 oncogene sequences by nested real time PCR
... LCRS/E7AS primer pair, 50 ng of "carrier" normal human DNA and serial log- arithmic dilutions of pHV101; they were preamplified for 15 cycles (denaturation at 94°C for 15 sec, annealing at 57°C for 1 min and ...
7
Leader Sequences Downstream of the Primer Binding Site Are Important for Efficient Replication of Simian Immunodeficiency Virus
... Long-term culture results in reversion of SD2 viruses. To investigate the possibility of reversion, we cultured the infected cells over longer periods and did not find any sign of reversion of the SD and SD3 constructs ...
7
Identification of Potential Methylation Regions of the Smad4 mRNA and Determining Primer Sequences for MS-PCR with the ‘Methprimer’ Program
... bisulphite sequences for these regions and designing relevant primer sequences of SMAD4 for reverse transcriptase ...We used the ‘MethPrimer’ program in the present ...
5
The effect of primer choice and short read sequences on the outcome of 16S rRNA gene based diversity studies
... commonly used, published primers targeting dispersed regions of the bacterial 16S rRNA gene for short read ...calculating primer coverage rates for each of the primers analyzed, and continued with the ...
14
Assessing alternative base substitutions at primer CpG sites to optimise unbiased PCR amplification of methylated sequences
... DNA from the cell lines KG1, KG1a and MDA-MB-231 and the peripheral blood from a normal volunteer were extracted using the QIAamp DNA blood mini kit (Qiagen, Hilden, Germany), with the added step of digesting the samples ...
9
Identification of sequences downstream of the primer binding site that are important for efficient replication of human immunodeficiency virus type 1.
... We also studied the ability of viruses derived from transfec- tions of COS-7 cells to infect MT-4 cells, using a p24 antigen capture assay. In this instance, we also examined viruses that had been subjected to more ...
8
SILAC Protein Quantitation Kits
... are used to generate peptides with 6- and 10-Da mass shifts, respectively, compared to peptides generated with light ...commonly used for SILAC labeling because of its prevalence in protein sequences ...
8
A primer on metagenomics.
... In contrast, the sequences obtained from environmental genomic studies are fragmented. Each fragment was obviously sequenced from a specific species, but there can be many different species in a single sample, for ...
14
Tissue-specific expression of human provirus ERV3 mRNA in human placenta: two of the three ERV3 mRNAs contain human cellular sequences.
... Because all three ERV3 mRNAs contained the same transcriptional initiation, splice donor, and splice acceptor sites (see above), and because probe r (located 1 to 2 kb downstream from th[r] ...
10
Table SI. Reverse transcription-quantitative PCR primer sequences. Primer sequence (5'-3')
... PCR primer sequences. Gene Primer sequence (5'-3') GNA12-FP AAGTCCACGTTCCTCAAGC GNA12-RP CCAAGGAATGCCAAGCTTATC BST2-FP TGATCTCATCAGTTCTGAGCGGGT BST2-RP AGACCTGCTCCAGAGGCCCTTCTC THPO-FP ...
10
Supplementary Table 1: Primer pair sequences for the analyses of gene expression.
... 1: Primer pair sequences for the analyses of gene ...Gene Primer pairs Reference Cycling conditions Actb fw 5' AGCTGCGTTTTACACCCTTT 3' rv 5' AAGCCATGCCAATGTTGTCT 3' [Cardoso et ...
6
Tab1e 1 Sequences of primers for target genes of amplified fragment. Gene Primer Sequences 5-3 CGTTCGACAAGGGTGACTAT TCGATTGCCACCAAAAGTGC
... Human Epidermal Melanocyte (PIG1) cells were exposed to UVB at doses ranging from 50 to 90mJ/cm 2 to measure melanin content with the NaOH method.. The tyrosinase activity of Human[r] ...
14
Megakaryocyte quantitation
... Megakaryocyte quantitation Lawrence A. Harker J Clin Invest. 1968;47(3):452-457. https://doi.org/10.1172/JCI105741. A method is described for the quantitation of megakaryocytes. In this technic bone marrow ...
7
Effects of alterations of primer-binding site sequences on human immunodeficiency virus type 1 replication.
... An early, critical step in the human immunodeficiency virus type (HIV-1) life cycle is reverse transcription of viral RNA into proviral DNA, which can then be integrated into the infecte[r] ...
9
Quantitation of cocaine on banknotes
... 5.2 Instrument Performance Daily instrument checks were carried out by injecting 2 µL of a solution containing 1 ng/µL of a mixture of drugs five times. These include cocaine, diamorphine, MDMA, amphetamine and THC. The ...
111
QUANTITATION OF DESTRUCTION OF TOXOPLASMA
... For example, there are approximately 8 to 16 Toxoplasma per vacuole by 24 hr and lysis or detachment of cells soon afterwards, there is uptake of radiolabeled nucleic acid precursors [r] ...
15
Bandwidth Primer The basic conditions and terms used to describe information exchange over networks.
... Why be concerned about bandwidth? The desktop computer world began with just that – a computer sitting on a desktop, accessible by one person, unconnected to other computers. That world has now evolved to include local ...
10
Immunoradiometric assay for examination and quantitation of Brucella abortus specific antibodies reactive with the antigen(s) used in the indirect hemolysis test
... IgGl, IgG2, and IgM were used to detect specific bovine antibodies of these classes (and subclasses).. The binding of the anti-immunoglobulins was linear as a function of immunoglobulin [r] ...
12