• No results found

r(GpG)-adduct

Crystal structure of the bora­benzene–2,6 lutidine adduct

Crystal structure of the bora­benzene–2,6 lutidine adduct

... Data collection: COLLECT Bruker, 2008; cell refinement: DENZO/SCALEPACK Otwinowski & Minor, 1997; data reduction: DENZO/SCALEPACK; programs used to solve structure: SUPERFLIP Palatinus &[r] ...

5

Tri­phenyl­boroxin N,N di­ethyl­hy­droxy­lamine adduct (di­methyl­form­amide solvate)

Tri­phenyl­boroxin N,N di­ethyl­hy­droxy­lamine adduct (di­methyl­form­amide solvate)

... made to collect data at lower temperature. Rapid cooling to 173 K resulted in break-up of the crystal and loss of the single- crystal diffraction pattern. Slow cooling revealed loss of the diffraction pattern at about ...

10

The tris­­(di­meth­oxy­ethane) adduct of strontium iodide

The tris­­(di­meth­oxy­ethane) adduct of strontium iodide

... Barr, D., Brooker, M. J., Doyle, S. R., Drake, S. R., Raithby, P. R., Snaith, R. & Wright, D. S. (1989). J. Chem. Soc. Chem. Commun. pp. 893–895. Bruker (1998). SHELXTL. Version 5.10. ...

7

N Imidazole–boron trichloride adduct

N Imidazole–boron trichloride adduct

... Data collection: SMART Bruker, 2002; cell refinement: SAINT Bruker, 2002; data reduction: SAINT and SHELXTL Bruker, 2002; programs used to solve structure: SHELXTL; programs used to refi[r] ...

5

A di­phenyl­boron chelate of an ethyl­enebis­hydroxyl­amine form­aldehyde adduct

A di­phenyl­boron chelate of an ethyl­enebis­hydroxyl­amine form­aldehyde adduct

... Analogous COBON chelate ring systems have been found in the diphenylboron complexes of the reaction products from N,N-dimethylhydroxylamine and formaldehyde Rettig et al., 1974 or aceton[r] ...

11

Chloral adduct of N hy­droxy­piperidine

Chloral adduct of N hy­droxy­piperidine

... Data collection: MSC/AFC Diffractometer Control Software Molecular Structure Corporation, 1992; cell re®nement: MSC/AFC Diffractometer Control Software; data reduction: TEXSAN Molecular [r] ...

7

Lithium tri­fluoro­methane­sulfonate aceto­nitrile adduct

Lithium tri­fluoro­methane­sulfonate aceto­nitrile adduct

... Data collection: SMART Bruker, 2000; cell re®nement: SAINT Bruker, 2000; data reduction: SAINT; programs used to solve structure: SHELXS97 Sheldrick, 1990; programs used to re®ne structu[r] ...

7

A paracetamol–morpholine adduct

A paracetamol–morpholine adduct

... #=============================================================================== # PLATON /CHECK-(191101) versus check.def version of 16/11/01 for entry: parmor # Data From: parmor_e.cif - Data Type: CIF Bond Precision ...

9

Redetermination of HI3O8, an adduct of formula HIO3·I2O5

Redetermination of HI3O8, an adduct of formula HIO3·I2O5

... Data collection: COLLECT Nonius, 1999; cell refinement: DIRAX/LSQ Duisenberg, 1992; data reduction: EVALCCD Duisenberg et al., 2003; programs used to solve structure: coordinates taken f[r] ...

5

Enhanced nucleotide excision repair capacity in lung cancer cells by preconditioning with DNA-damaging agents

Enhanced nucleotide excision repair capacity in lung cancer cells by preconditioning with DNA-damaging agents

... Pt-GpG adduct [3, ...Pt-GpG adduct removal following UV-PreC, UV-CDP or UV-6-4PP removal following Pt-PreC and Pt-GpG removal following Pt-PreC were enhanced compared to nonPreC ...

12

Small Molecule Targets Env for Endoplasmic Reticulum-Associated Protein Degradation and Inhibits Human Immunodeficiency Virus Type 1 Propagation

Small Molecule Targets Env for Endoplasmic Reticulum-Associated Protein Degradation and Inhibits Human Immunodeficiency Virus Type 1 Propagation

... that GPG-NH 2 acts adversely on a unique step in gp160 mat- ...of GPG-NH 2 , a mutant version of gp160 ( ⌬ nSS-gp160) was created lacking the entire n-region of its signal sequence ...by GPG-NH 2 ...

10

A framework for detecting and preventing security vulnerabilities in continuous integration/continuous delivery pipelines

A framework for detecting and preventing security vulnerabilities in continuous integration/continuous delivery pipelines

... CONTROL Users must authorize to push a commit Commits have to be cryptographically signed by the author with GPG Verify hashes outside of the Production Line and only allow verified libr[r] ...

129

Crystal structure of the co crystalline adduct 1,3,6,8 tetra­aza­tri­cyclo­[4 4 1 13,8]do­decane (TATD)–4 chloro 3,5 di­methyl­phenol (1/1)

Crystal structure of the co crystalline adduct 1,3,6,8 tetra­aza­tri­cyclo­[4 4 1 13,8]do­decane (TATD)–4 chloro 3,5 di­methyl­phenol (1/1)

... co-crystalline adduct. A view of this adduct is shown in ...1:2 adduct with 4-bromophenol (Rivera, Uribe, Rojas et ...1:1 adduct with hydroquinone (Rivera et ...1:2 adduct and 2.767 (2) ...

9

The Monterrey process on financing for development - the European Union's contribution to Doha and beyond. Annual progress report 2008. Commission staff working paper accompanying COM (2008) 177 final. SEC (2008) 432 final, 9 March 2008

The Monterrey process on financing for development - the European Union's contribution to Doha and beyond. Annual progress report 2008. Commission staff working paper accompanying COM (2008) 177 final. SEC (2008) 432 final, 9 March 2008

... 8 Global Public Goods "The Council calls on the Member States and the Commission to strengthen their action on global public goods GPG through enhanced collaboration and alliance-buildin[r] ...

48

Hydroxyalkylation of Cyclic Imides with Oxiranes  Part II  The Mechanism of Reaction in Presence of Triethylamine

Hydroxyalkylation of Cyclic Imides with Oxiranes Part II The Mechanism of Reaction in Presence of Triethylamine

... 2) The initial step of reaction is the formation of 1:1 imide: TEA adduct, which intermediates the proton tran- sfer from imide to oxirane. The adducts could not be iso- lated, although their presence in solutions ...

6

Early years education in Qatar: The good practice guide in theory and practice

Early years education in Qatar: The good practice guide in theory and practice

... When participants were asked about their recommendations, their responses raise additional issues regarding outside forces such as parents and domestic servants, the role of teachers and the use of curriculum standards ...

16

The 1:1 adduct of 1,3,5 tri­nitro­benzene with 1,2,3,4 tetra­hydro­quinoline

The 1:1 adduct of 1,3,5 tri­nitro­benzene with 1,2,3,4 tetra­hydro­quinoline

... [(THQ)(TNB)], (I), formed as the sole product in the reaction of THQ with 2,4,6-trinitrobenzoic acid (with decarboxylation). The cell dimensions and space group for this compound were reported by Herbstein et al. (1976), ...

11

An O bridged BONBON ring system (phenol adduct)

An O bridged BONBON ring system (phenol adduct)

... phenol adduct show some differences from those in the parent crystal, presumably as a consequence of changes in electron density resulting from the donation of one of the lone pairs of the bridging oxygen to the ...

11

The 1:1 adduct of 3,5 di­nitro­benzoic acid and quinoline

The 1:1 adduct of 3,5 di­nitro­benzoic acid and quinoline

... quinuclidine (Chantrapromma et al., 2004) and hexamethyl- enetetramine (Fun et al., 2003; Chantrapromma et al., 2006; How et al., 2005). The H-transfer process occurs in these adducts and the adduct of ...

8

Increased Mortality in Young Candidemia Patients Associated with Presence of a Candida albicans General Purpose Genotype

Increased Mortality in Young Candidemia Patients Associated with Presence of a Candida albicans General Purpose Genotype

... pmol each of primers MG1pf (CCTCCCTTCTCTTAAGAG) and MG1pr (AA CAGGAGAGGTTAAGAG), 2 pmol each of primers YW1pf (TCAAGTTCT GCTTCCCCATCG) and YWP1pr (CGTGGACCGTAGTGACACCAATAC), and 1 unit Taq polymerase (Qiagen). Cycling ...

7

Show all 10000 documents...

Related subjects