receptor for advanced glycation end product

Top PDF receptor for advanced glycation end product:

Imaging receptor for advanced glycation end product expression in mouse model of hind limb ischemia

Imaging receptor for advanced glycation end product expression in mouse model of hind limb ischemia

RAGE is a 35 kDa polypeptide of the immunoglobulin superfamily that is a multiligand receptor shown to play an important role in vascular disease [2-11]. This receptor is constitutively expressed in low levels on smooth muscle cells and endothelial cells in vascular walls [4]. RAGE binds ligands that induce expression and activation of sig- naling pathways important in promoting inflammation and reducing vascular reactivity. These ligands include ad- vanced glycation endproducts (AGEs), S100/Calgranulin proteins, high-mobility group box 1 protein (HMGB1), and oxidized LDL. Ligand-RAGE binding activates intra- cellular pathways that generate reactive oxygen species, re- duce nitric oxide availability, promote monocyte and

8 Read more

Soluble receptor for advanced glycation end product (sRAGE)/pentosidine ratio: a potential risk factor determinant for Type 2 diabetic retinopathy

Soluble receptor for advanced glycation end product (sRAGE)/pentosidine ratio: a potential risk factor determinant for Type 2 diabetic retinopathy

time when retinopathy complication was first diagnosed in the patients; e Oral medications and insulin; f Inclusive of angiotensin-converting enzyme inhibitors, angiotensin II type I receptor antagonists, calcium channel blockers and diuretics; ALT = alanine aminotransferase; AST = aspartate aminotransferase; BMI = body mass index; Ctrl = healthy controls; DBP= diastolic blood pressure; DNR = diabetic non-retinopathy; DR = diabetic retinopathy; eGFR = estimated glomerular filtration rate; HbA 1c = glycated haemoglobin; HDL-C = high-density lipoprotein cholesterol; LDL-C = low-density lipoprotein

12 Read more

Longistatin in tick saliva blocks advanced glycation end product receptor activation

Longistatin in tick saliva blocks advanced glycation end product receptor activation

chiefly recognized by the prototypic DAMP receptor, receptor for advanced glycation end products (RAGE). RAGE is a transmem- brane, multiligand receptor belonging to the immunoglobulin super family (10). Full-length RAGE (flRAGE) is 404-aa long, con- sisting of a V domain (aa 23–116) followed by 2 C domains (C1, aa 124–221, and C2, aa 227–317), a transmembrane domain (aa 343– 363), and a short cytosolic tail (aa 364–404) (7, 10, 11). RAGE is highly expressed during embryonic development. In adult tissues, it is constitutively expressed at high levels in skin and lungs, but at low levels in other normal tissues, including on cells involved in the innate immune system, for example, neutrophils, macrophages, monocytes, eosinophils, basophils, dendritic cells, lymphocytes, and endothelial cells (7, 12–14). However, its expression increases at the site of inflammation or where its ligands are accumulated. RAGE/ligand interaction initiates sustained cellular activation through receptor-dependent signaling involving the transcription factor NF-κB and proinflammatory cytokine production, leading to leukocyte recruitment and subsequent initiation of inflammation in different pathological settings (7, 15, 16). Owing to severe tissue damage, it is quite reasonable that tick biting, at least at the site of attachment, causes the release of DAMPs from the devitalized tis- sues and is most likely to be responsible for igniting inflammatory responses, which tend to prevent the damaging activities of ticks. However, ticks can cleverly manage the host responses developed against the biting insult to ensure a sufficient blood meal. Ticks’ salivary gland molecules are thought to have pivotal roles in the successful feeding on blood meals from hosts (17–19).

17 Read more

<p>Loratadine Alleviates Advanced Glycation End Product-Induced Activation of NLRP3 Inflammasome in Human Chondrocytes</p>

<p>Loratadine Alleviates Advanced Glycation End Product-Induced Activation of NLRP3 Inflammasome in Human Chondrocytes</p>

Histamine receptor 1 (H1R), a type of G protein-coupled receptor, is an important member of the histamine receptor family. 8 Previous research has shown that H1R is expressed in human chondrocytes and is responsive to histamine sti- mulation, which induces the production of numerous pro- in fl ammatory mediators and several matrix metalloprotei- nases (MMPs). 9 – 11 Additionally, H1R activation has been shown to promote proteoglycan synthesis in chondrocytes. 12 These facts indicate that H1R signaling could play a role in chondrocyte regulation. H1R antagonists have been used to relieve allergenic symptoms for decades and provide a powerful tool to study the function of the H1 receptor. Loratadine is a second-generation antihistamine, which acts as an H1R blocker. 13 Loratadine has been widely used to treat allergic symptoms associated with hay fever, seasonal allergies, and atopic dermatitis. 14 In addition, loratadine has displayed pleiotropic functions in different types of cells and tissues. 15 – 17 However, the roles of loratadine in the

10 Read more

Original Article Relationship of advanced glycation end products and their receptor to pelvic organ prolapse

Original Article Relationship of advanced glycation end products and their receptor to pelvic organ prolapse

A total of 24 patients and 25 controls were ran- domly chosen from the entire study cohort for RAGE gene sequencing. After the DNA was extracted, RAGE was genotyped by PCR using the following primer sequences: AGER-1F: 5’ AAAGGCATGAATTCCTAGCATT 3’, AGER-1R: 5’ GGTTGAAGGCTTTTTCTTAGGTA 3’; AGER-2F: 5’ TCCAGGATGAGGGGATTTT C 3’, AGE-2R: 5’ AGER-2R: 5’ ACCCTTGTCTTTTTGTCTCCATA 3’, AGER-3F: 5’ TAGGGTGAACCATAACTAGCAAC 3’, AGER-3R: 5’ TGGTATAGTATGGTGAAGTATGGG 3’, PCR reactions were performed in 20-μL reac- tion volumes containing 10 mM Tris HCl (pH 8.9), 50 mM KCl, 1.5 mM MgCl 2 , 0.2 μM of each primer, 250 μM of each dNTP, 50 ng of genomic DNA, and 0.5 units of Taq thermosta- ble DNA polymerase (ABI, Foster city, CA, USA). Cycling parameters were 5 minutes at 95°C, followed by 35 cycles of 30 seconds at 95°C, 30 seconds at the annealing temperature (Tm) of the primers (52°C-63°C, see Table S1, Additional File 1), and 45 seconds to 1 minute at 72°C, with a final 10minute extension at 72°C [24-26]. Finally, the sequence of the entire PCR product was determined by 3730 sequence analyzer (ABI, Foster city, CA, USA). Animals

13 Read more

Advanced glycation end products cause epithelial myofibroblast transdifferentiation via the receptor for advanced glycation end products (RAGE)

Advanced glycation end products cause epithelial myofibroblast transdifferentiation via the receptor for advanced glycation end products (RAGE)

ber of the immunoglobulin superfamily is the best characterized of the AGE receptors (37). Purified RAGE migrates as a single band on SDS-PAGE, but has been shown to appear as a doublet due to posttranslational modification of the molecule (29). The lower-molecu- lar-weight binding site detected with ligand blotting was initially considered possibly to represent the pres- ence of lysozyme in our membrane preparation, because lysozyme has been shown previously to bind AGEs (36). Immunoblotting failed to confirm this, and the identity of the band remains unclear and may rep- resent a RAGE breakdown product. However, the rela- tive importance of the binding sites seen in this study, and specifically the relevance of the AGE-RAGE inter- action, was further confirmed by the ability of a well- characterized neutralizing Ab to RAGE to prevent AGE-mediated transdifferentiation.

12 Read more

Advanced glycation end products increase lipids accumulation in macrophages through upregulation of receptor of advanced glycation end products: increasing uptake, esterification and decreasing efflux of cholesterol

Advanced glycation end products increase lipids accumulation in macrophages through upregulation of receptor of advanced glycation end products: increasing uptake, esterification and decreasing efflux of cholesterol

particular in the setting of diabetes. AGEs binding to RAGE activates various signalling pathways, including NADPH oxidases, mitogen-activated protein kinases (MAPKs), p21 ras , ERK p38 and protein kinase C (PKC), and finally leads to sustained cellular dysfunction driven by long-term activation of the nuclear factor-kB (NF- kB) [27, 28]. The importance of AGEs as downstream mediators of hyperglycaemia in diabetes has been amply demonstrated by animal studies using inhibitors of advanced glycation to retard the development of vascular disease without directly influencing plasma glucose levels [29, 30]. Furthermore, dietary excess of AGEs has been shown to accelerate atherosclerosis without affecting glycaemic control [31]. Studies in vivo showed that administration of soluble RAGE (sRAGE), a truncated form of RAGE acting as a decoy for AGE, completely suppressed diabetic atherosclerosis in glycemia- and lipid-independent manners [13]. In diabetes- associated atherosclerosis models, RAGE overexpression in transgenic mice was associated with increased vascular

13 Read more

Key words

Key words

The activity of cathepsin B in both the PMN extracts and plasma was measured according to Barrett [17] with the use of the fluorescent sub− strate CBZ−Arg−Arg−NMec. The results were expressed in mU/l for plasma and mU/mg of pro− tein (estimated by Lowry method [18]) for the PMN extracts. One milliunit (mU) of enzyme activity was defined as 1 µmol of the reaction product released per minute. AOPP concentration in plasma was measured by a spectrophotometric assay according to Witko−Sarsat et al. [15] and expressed in µmol/l using a calibration curve made for chloramine T, which absorbs at 340 nm in the presence of potassium iodide. Plasma glucose, blood glycated hemoglobin, cholesterol, and triglycerides were determined using routine clini− cal assays.

7 Read more

A REVIEW ON DIABETES INDUCED MEMORY IMPAIRMENT

A REVIEW ON DIABETES INDUCED MEMORY IMPAIRMENT

4) N- methyl-D- aspartate receptor (NMDA) antagonist: Glutamate is found in the neuronal pathways associated with learning and memory. In 2003, the FDA approved memantine (namenda), a non-competitve NMDA receptor antagonist moreover which has been used to treat moderate to severe stages of memory impairment by blocking NMDA receptors and inhibiting their overstimulation by glutamate, protects the brain cells from damage caused by glutamate. [28]

6 Read more

RAGE Gly82Ser polymorphism in patients with type 2 diabetes with comorbid depression

RAGE Gly82Ser polymorphism in patients with type 2 diabetes with comorbid depression

Results: Of the 114 subjects, 72(63.15%) were clinically depressed. Lower levels of endogenous secretory receptor were found in the depression group compared with the other group (p=0.049). No difference in genotypes or allele frequencies existed between the two groups (p>0.05). Gly82Ser carriers had significantly higher Hamilton Rating Scale scores (p<0.001) and lower serum endogenous secretory receptor (p=0.012) among the depressed diabetics. There were also significant differences in body mass index (p=0.005), abdominal circumference (p=0.038), carotid intima-media thickness (p=0.037) and high-sensitivity C-reactive protein (p=0.005) concentration between the different genotypes.

6 Read more

Receptor for advanced glycation end products (RAGE) regulates sepsis but not the adaptive immune response

Receptor for advanced glycation end products (RAGE) regulates sepsis but not the adaptive immune response

As reported for pattern-recognition receptors (PRRs) of the innate immune system, RAGE is a receptor that recognizes a three- dimensional structure rather than a specific amino acid sequence (5, 6, 8, 44). RAGE binds several peptides, including advanced gly- cated end products, amyloid β-peptide, S100 proteins, and ampho- terin, also known as high-mobility group protein B1 (HMGB1), all of which are characterized by the presence of β-sheet structures and fibrils (20, 28, 45). sRAGE functions as a “decoy” by binding RAGE ligands and preventing their interaction with cell surface RAGE. However, sRAGE also has the capacity to prevent ligands from interacting with receptors other than RAGE. In order to be certain that a particular response was RAGE dependent, it was nec- essary to generate and study homozygous RAGE-null (RAGE –/– )

11 Read more

Serum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, and classical risk markers of joint and vascular damage in rheumatoid arthritis

Serum levels of soluble receptor for advanced glycation end products and of S100 proteins are associated with inflammatory, autoantibody, and classical risk markers of joint and vascular damage in rheumatoid arthritis

Introduction The receptor for advanced glycation end products (RAGE) is a member of the immunoglobulin superfamily of cell surface receptor molecules. High concentrations of three of its putative proinflammatory ligands, S100A8/A9 complex (calprotectin), S100A8, and S100A12, are found in rheumatoid arthritis (RA) serum and synovial fluid. In contrast, soluble RAGE (sRAGE) may prevent proinflammatory effects by acting as a decoy. This study evaluated the serum levels of S100A9, S100A8, S100A12 and sRAGE in RA patients, to determine their relationship to inflammation and joint and vascular damage. Methods Serum sRAGE, S100A9, S100A8 and S100A12 levels from 138 patients with established RA and 44 healthy controls were measured by ELISA and compared by unpaired t test. In RA patients, associations with disease activity and severity variables were analyzed by simple and multiple linear regressions.

11 Read more

Increased skin autofluorescence of children and adolescents with type 1 diabetes despite a well-controlled HbA1c: results from a cohort study

Increased skin autofluorescence of children and adolescents with type 1 diabetes despite a well-controlled HbA1c: results from a cohort study

The study design was a retrospective cohort study of pa- tients with type 1 diabetes and healthy controls. Patients aged 11–19 years with type 1 diabetes ≥3 months were recruited between April 2010 and January 2013 while visiting the outpatient clinic of Diabeter, a certified center of reference for diabetes care in Rotterdam, Netherlands. Diabeter provides comprehensive and advanced manage- ment for children and adolescents with type 1 diabetes. Patients were only included if they were Caucasian and if measurements of SAF and HbA1c were performed on the same day. Patients with inadequately controlled celiac disease, hypothyroidism, and those using lipid-lowering therapy were excluded.

8 Read more

Glycation and Advanced Glycation End-Products in Laboratory Experiments in Vivo and in Vitro

Glycation and Advanced Glycation End-Products in Laboratory Experiments in Vivo and in Vitro

The laboratory data describing glycemic control para- meters of diabetic and non-diabetic subjects, both suffering from the cataractous lens, are summarized in Table 1. As expected, the diabetic group has statistically higher levels of serum glucose, serum fructosamine, and HbA1c in erythro- cytes than non-diabetics (P < 0.01). Analysis of lenses re- vealed a significant increase in both glycated lens proteins of diabetics compared with the controls (0.15 vs 0.08 nmol/mg protein, P < 0.01) and AGE-linked fluorescence at 440 nm (4.8 vs 2.8 AU/mg protein, P < 0.01). There were no associa- tions between the AGE fluorescence and the concentration of serum glucose (r=0.23, NS), fructosamine (r=0.25, NS), HbA1c (r=0.15, NS), or lens glycation (r=-0.42, NS). Also, we did not find any relationship between the level of lens glycation and serum glucose (r=0.26, NS), fructosamine (r=0.29, NS), or HbA1c (r= 0.17, NS). Fig. 2 presents typi- cal emission spectra of AGE products formed in the cata- ractous lenses.

5 Read more

Download
			
			
				Download PDF

Download Download PDF

Abstract. The receptor for advanced glycation end products (RAGE) has been involved in the actions of inflammatory proteins such as S100 calcium binding protein B (S100B), among several others. Despite there being many studies available proposing several different modes of interaction between the receptor and the protein, it is necessary to reconcile these binding hypotheses. We evaluated the co-localization of RAGE and S100B in human umbilical vein endothelial cells (HUVEC’s) exposed to acute pro-inflammatory lipopolysaccharide (LPS). Co- localization of the receptor and the protein in umbilical cells exposed to pro-inflammatory stimuli was analyzed using an immunofluorescent assay. RAGE was present in umbilical cells, and its co-localization with S100B was stimulated in the presence of LPS. Our findings suggest an interaction between these proteins, possibly producing early inflammatory responses in umbilical cells. The understanding of the molecular mechanisms of this recognition is relevant to characterize the nature of the signaling associated with this receptor in inflammatory processes. Keywords: Inflammation; Lipopolysaccharide; Molecular recognition; Co-localization; Umbilical endothelial cells.

8 Read more

Modulating impacts of quercetin and/or lactoferrin on diabetic nephropathy and cardiomyopathy induced rats

Modulating impacts of quercetin and/or lactoferrin on diabetic nephropathy and cardiomyopathy induced rats

The concentration of AGEPs (a biomarker of protein glycation) and CTGF (a biomarker of tissue fibrosis) in both kidney and heart tissues of normal and different diabetic groups were illustrated in Figures 2 and 3 respectively. Induction of diabetes in rats dramatically led to increase in the level of AGEPs as well as in the expression of CTGF in both kidney and heart of diabetic rats versus control non-diabetic animals (P≤ 0.001). Injection of diabetic rats with Qr and /or bovine LF, successfully down-modulated the increases in the above parameters in relation to diabetic untreated animals (P≤ 0.001).

10 Read more

Multimodal imaging of the receptor for advanced glycation end-products with molecularly targeted nanoparticles

Multimodal imaging of the receptor for advanced glycation end-products with molecularly targeted nanoparticles

in medium supplemented with 5.5 mM (control) and 14 mM glucose for 12 h to induce the overexpression of RAGE. For fluorescence binding studies, culture medium was replaced with staining buffer containing 10% FBS in pH 7.4 PBS. For binding of radiolabeled probes, cells were first lifted using Accutase and then suspended in 0.6 mL microcentrifuge tubes with staining buffer. A final volume of 100 µL containing a known amount of fluorescent or radiolabeled targeted and non-targeted nanoparticles was then used for binding studies at 37 °C at different times or concentrations. At the end of the indicated incubation period, the supernatant was discarded and unbound material was rapidly removed by washing the plate three times with PBS. The fluorescence intensity was measured with a Hybrid Multimode Microplate Reader (BioTek, USA) with an excitation wavelength of 520 nm and an emission wavelength of 550 nm, and radioactivity was measured using a gamma well

13 Read more

LL 37 induced cystitis and the receptor for advanced glycation end products (RAGE) pathway

LL 37 induced cystitis and the receptor for advanced glycation end products (RAGE) pathway

It has been well described that Toll-like receptors (TLRs), specifically TLR2 and TLR4, are involved in HMGB1 signaling [43-45]. HMGB1 can act as a ligand and bind not only the RAGE receptor [46], but TLR2 and TLR4. TLRs are a family of conserved proteins that en- able cells of the immune system to respond to microbial structures. TLR2 has been shown to respond to gram- positive components and fungi and TLR4 is the main receptor for endotoxin. Both TLR2 and TLR4 have been shown to be present in the lower urinary tract and bladder urothelium [27] and play a vital role in molecular defense mechanisms during urinary tract infection [47-49]. TLR2 also has been implicated in inflammatory responses in the urinary system and may play a role in progressive tissue fibrotic changes [50]. The signaling cascades initiated by TLR2 and TLR4 are complex. Similar to RAGE activation, the most prominent effect of TLR activation is the induction of NF-κB dependent gene expression. Overall, HMGB1 activation of TLR2 and/or TLR4 could both initiate and sustain a pro-inflam- matory phenotype, ultimately explaining the increased expression of NF-κB dependent genes. With this know- ledge, along with our data demonstrating such profound up-regulation of NF-κB dependent genes, further studies are needed to elucidate the role of TLRs.

8 Read more

Association of advanced glycation end products in Dupuytren disease

Association of advanced glycation end products in Dupuytren disease

The association of AGEs or Nox family in DD is not well known. Rosenbloom et al. reported that AGEs in- creased tissue stiffness in DD patients, but its mechan- ism was not fully described [31]. In our study, the addition of AGEs to DD-derived cells led to greater superoxide free radical formation. Increased AGE depos- ition and increased RAGE expression were also observed in the palmar fasciae of DD patients relative to those in the controls. The expressions of Nox-1 and Nox-4 as well as of ROMO1, an oxidatively damaged protein, were also higher in DD patients than in controls. These data suggested that the AGEs – RAGE interaction might produce free radicals via Nox activation in DD patients, and the pathogenesis of DD is associated with deposition of AGEs within the palmar fascia. Increased oxidative stress might induce increased AGE formation because glycation and oxidation influence each other [32].

7 Read more

The usefulness of soluble receptor for advanced glycation end-products in the identification of COPD frequent exacerbator phenotype

The usefulness of soluble receptor for advanced glycation end-products in the identification of COPD frequent exacerbator phenotype

Patients and methods: Patients with COPD in “D” GOLD category were monitored for 3 years according to events of ECOPD. Serum samples were collected from the patients. Circulating level of plasma soluble receptor for advanced glycation end-products (sRAGE) was measured using commercially available high sensitivity kits. The receiver operating characteristic (ROC) curve analysis was used to assess the usefulness of sRAGE to identify frequent exacerbator phenotype. Log-rank test was used in the analysis of time to the subsequent exacerbation. Pearson (R) or Spearman’s rank (R S ) correlation coefficients were used for correlation analysis.

6 Read more

Show all 10000 documents...

Related subjects