Sequence alignment of the somatic main H1 subtypes
Pairwise Sequence Alignment
... continuous main diagonal shows perfect similarity for symbols with the same ...the main diagonal indicate repeated regions in the same reading direction on different parts of the ...the sequence (D1, ...
35
Optimization of sequence alignment for simple sequence repeat regions
... SSR alignment tool (SALT) SALT is a new tool for making an alignment for SSR loci using the new ...the main window of the program which consists of five textboxes for the names or the directories for ...
9
Minimum-risk sequence alignment for the alignment and recognition of action videos
... Temporal alignment of videos is an important requirement of tasks such as video compar- ison, analysis and ...the main guiding element for the temporal alignment are the human actions depicted in the ...
11
Faster and efficient algorithm for sequence alignment
... Dot-matrix representation is efficient to give an overall picture of discrete and/or repeated regions of similarity between sequences. The sequences are arranged in 2 dimensional matrix and a dot is placed in any region ...
32
Bioinformatics sequence alignment on a GRID architecture
... PALABRAS CLAvE: Computación HTC, Grid, Infraestructura Cluster, Condor, Blast. ANALYTICAL SUMMARY Tools such as high performance computational technologies have become very useful, used by research centers for running ...
10
Sequence embedding for fast construction of guide trees for multiple sequence alignment
... To further illustrate this scalability we use RF00005, the largest entry in the Rfam database [31]. RF00005 contains 381,601 tRNA sequences, ranging between 74-95 nucle- otides in length. The similarity in length among ...
11
Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV)
... multiple sequence alignments (MSAs) is a fundamental requirement in the analysis of protein sequences, allowing us to visu- alize conservation across protein families as well as unusual features of particular ...
10
A Tabu Search Approach to Multiple Sequence Alignment
... Effective sequence alignment methodologies also provide insight into the structure\ function of a sequence and are the first step in constructing evolutionary ...two main tabu searches that ...
114
DNA Sequence alignment using programme by algorithm
... Miropeats alignment diagrams but they have their own particular ...single sequence. A sequence can be plotted against itself and regions that share ...
5
Cluster Analysis Method for Multiple Sequence Alignment
... individual sequence regions, is qualitative and simple, though time-consuming to analyze on a large ...certain sequence features—such as insertions, deletions, repeats, or inverted repeats—from a dot-matrix ...
7
FPGA-based protein sequence alignment : A review
... Abstract. Sequence alignment have been optimized using several techniques in order to accelerate the computation time to obtain the optimal score by implementing DP-based algorithm into hardware such as ...
5
BioBCDM: A novel integrated tool in Sequence alignment
... The main goal of our project was to unify some of these existing bioinformatics applications and in one easy-to-use surroundings, freelance of the computing platform, being a concentrator resource tool with a ...
6
Differential affinity of mammalian histone H1 somatic subtypes for DNA and chromatin
... and H1° are heterogeneously distributed in cell ...ticular subtypes and thus contribute to their heterogene- ous ...the H1 sub- types of chicken erythrocytes [53]. Subtypes with prefer- ence ...
11
A Step Towards Sequence-to-Sequence Alignment
... Fig. 5 illustrates that temporal alignment is not limited to motion information alone. A light source was brightened and then dimmed down, resulting in observable illumination variations in the scene. The cameras ...
8
An enhanced RNA alignment benchmark for sequence alignment programs
... (fast) sequence alignment programs using new or optimized program ...of alignment programs to multiple "sequence" alignment programs because – at least for the computing resources ...
11
An enhanced RNA alignment benchmark for sequence alignment programs
... (fast) sequence alignment programs using new or optimized program ...of alignment programs to multiple "sequence" alignment programs because – at least for the computing resources ...
11
Figure S1. Sequence alignment of RBP proteins head domains. A. Sequence alignment of the RBP
... ATGGGAGTTAGCAAAGGTGAAGAACTGTTTACGGGCGTTGTGCCGATCCTGGTGGAACTGGACGGTGA TGTTAATGGTCATAAATTCTCTGTGAGTGGCGAAGGTGAAGGCGATGCGACCTATGGTAAACTGACGC TGAAATTTATTTGCACCACCGGTAAACTGCCGGTTCCGTGGCCGACCC[r] ...
15
DNA Sequence Alignment Analysis
... Click on the box by any set you want to omit, and the tick mark should go away. This sequence (or set of sequences) will no longer be included in analyses. To reverse this decision, click to get the tick back ...
20
Fractal MapReduce decomposition of sequence alignment
... the sequence comparison procedure described here performed without recourse to dynamic programming alignment, but multiple layers of nested map-reduce distribution provide maximally parallelized workflows ...
12
Sequence Alignment/Map Format Specification
... To find the alignments that overlap a specified region, we need to get the bins that overlap the region, and then test each alignment in the bins to check overlap. To quickly find alignments associated with a ...
16