Transcriptional start sites (TSS)
Cloning and Promoter Identification of Acetoacetyl-CoA Thiolase Gene from Oil Palm, Elaeis guineensis Jacq.
... of transcriptional start site (TSS) is important in order to discern either the location of promoter or regulatory regions of the gene of ...three transcriptional start sites ...
5
Marek’s disease virus challenge induced immune related gene expression and chicken repeat 1 (CR1) methylation alterations in chickens
... around transcriptional start sites (TSS) of STAT1 and IL12A were investigated (we named them as STAT1_CGI and IL12A_CGI, respectively) by the py- rosequencing ...CpG sites which are 345 ...
10
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
... these transcriptional start sites in the context of the existing gene models and tiling microarray ...the start or end of annotated genes: 41 (44%) are located inside the last one-third of ...
13
10c8db7b4dcda2ac7c018dd4ced2ad70b6f55408.pdf
... binding sites of the p50 and p65 subunits of NF-κB throughout the ...binding sites for both p50 and p65 in chromatin from primary hepatocytes derived from PHD1 -/- mice compared to WT controls (Figure ...
29
Mutational analyses of the intergenic dinucleotide and the transcriptional start sequence of vesicular stomatitis virus (VSV) define sequences required for efficient termination and initiation of VSV transcripts.
... mRNA start site and most of the mutations in the nontran- scribed dinucleotide did not appear to significantly decrease G protein expression from ...the start sequence, while changes at nt 4 and 5 had less ...
11
Integration Site Preference of Xenotropic Murine Leukemia Virus-Related Virus, a New Human Retrovirus Associated with Prostate Cancer
... fragile sites, FRA16C, and the normal allele of the rare fragile site FRA16B that harbors AT-rich minisatellite repeats ...integration sites, one each located in ...integration sites and any ...
14
Identification of Epigenetic Interactions between MicroRNA and DNA Methylation Associated with Polycystic Ovarian Syndrome
... 2.8 Methylation analysis of promoter region of miRNA associated with miRNA target gene expression The transcription start site (TSS) data of DEmiRs were extracted from the FANTOM5 datab[r] ...
17
Mechanisms of transcriptional activation of the stimulator of interferon genes by transcription factors CREB and c-Myc
... binding sites by using online software (TFSEARCH) revealed the presence of several putative binding sites, including CREB, Sp1, E2F, HOX and c-Myc, in the promoter region of STING ...binding sites to ...
9
Aspects of DNA replication initiator proteins of Escherichia coli and its bacteriophage
... 182 a possible gene A* promoters possible transcriptional start -35 -10 ~ 4401 TATTCGCGATGA TGCTGAACGCCCTCWT gene A* start > 5 44 60 TTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACT Met Lys Ser Ar[r] ...
227
ATF3 rSNPs, transcriptional factor binding sites and human etiology
... GWAS over the last decade have identified nearly 6500 disease or trait-predisposing SNPs where only 7% of these are located in protein-coding regions of the genome [23,24] and the remaining 93% are located within non- ...
9
Transcriptional activities of mammalian genomes at sites of recombination with foreign DNA.
... Analyses of the unoccupied insertion sites corresponding to sites of integration or recombination from the Ad2transformed hamster cell line HE5, the Adl2-induced mouse tumor CBA-12-1-T, [r] ...
10
Varicella-Zoster Virus Gene 21: Transcriptional Start Site and Promoter Region
... To construct plasmids placing VZV ORFs 4, 10, 61, 62, and 63 under the control of the cytomegalovirus (CMV) IE promoter (pCIneo; Promega), the VZV ORFs, along with 6 to 1,817 bp of flanking sequences, were shuttled into ...
6
Genetic basis of the highly efficient yeast Kluyveromyces marxianus: complete genome sequence and transcriptome analyses
... the TSS analysis data for survival at high temperature: alteration of ribo- some biogenesis including pre-rRNA processing pre- sumably for stable and efficient protein synthesis, reduction of mitochondrial ...
14
Genome-Wide Characterization of DNA Methylation in an Invasive Lepidopteran Pest, the Cotton Bollworm Helicoverpa armigera
... methyl groups from lysines 9 and 36 in histone H3 (H3K9 and H3K36) (Klose et al. 2006), and therefore plays a role in reversing histone meth- ylation, which itself is associated with transcriptional activity. The ...
10
Assessment of water quality in the river gomati at Jaunpur (U.P.), India.
... TDS, TSS, nitrate, nitrite and other parameters at some of the sites were beyond the permissible limit, water was polluted and is not suitable for beneficial uses without conventional ...
6
AKT3 rSNPs, Transcriptional Factor Binding Sites and Human Disease
... a transcriptional factor binding site (TFBS) can change a transcriptional factor’s (TF) ability to bind its TFBS [11-14] in which case the TF would be unable to effectively regulate its target gene ...
14
Key determinants of target DNA recognition by retroviral intasomes
... Genomic DNA (20 μg) isolated using the DNeasy Blood and Tissue Kit (Qiagen) was digested overnight with AvrII, NheI, and SpeI and purified using the QIAquick PCR Purification Kit (Qiagen). A double-stranded asym- metric ...
19
General method for production and selection of infectious vaccinia virus recombinants expressing foreign genes.
... These insertion vectors contain transcriptional regulatory signals, the RNA start site of an early vaccinia virus gene, multiple unique restriction endonuclease sites for insertion of fo[r] ...
8
BET inhibition as a single or combined therapeutic approach in primary paediatric B-precursor acute lymphoblastic leukaemia
... addressed transcriptional markers of sensitivity to BET inhibition in primary ALL samples and observed that the cytotoxic response correlated with the expression of MYC and its target CDKN1A and that cases with ...
10
Molecular genetic investigations of rod cyclic GMP phosphodiesterase beta subunit in canine generalised progressive retinal atrophy
... There are a variety of methods available to detect differences in nucleotide sequence. In this case, known restriction enzyme sites remain unaltered by the mutation, so detection by genomic Southern blotting is ...
281