Words That Rhyme with Val
Hafez: an Interactive Poetry Generation System
... We learn new default configurations using the data gathered from Mechanical Turk. As we explained in section 2.4, we examine the effect of different feature weights like repetition and sentiment on star ranking scores. ...
6
Effect of Visual-Perceptual Exercises Based on Frostig Model on Reading Improvement in Dyslexic Students
... reading words, Words chain, rhyme, calling the figure, text comprehension, words comprehension, voices removal, reading unfamiliar words, letters signs and category signs components and ...
18
On the Romanian Rhyme Detection
... Identifying words without rhyme is an important problem for poets and especially for automatic or assisted poetry ...of words in poetry can provide valuable information about dialect and ...
8
Unsupervised Discovery of Rhyme Schemes
... and rhyme (where the stress and rhyming information is derived from a pronunciation dictionary) into a machine translation ...the rhyme network (Son- deregger, 2011) in ...
6
A Rule based Approach for Karmina Generation
... We consider our work to have different focus and pose different challenges. The first thing is that the meaning of a Karmina can be understood di- rectly. This property might be different from other type of poetry which ...
8
Deep speare: A joint neural model of poetic language, meter and rhyme
... predict rhyme for a word pair by feeding them to the rhyme model and computing cosine similarity; if a word pair is assigned a score > ...to rhyme. As a baseline (Rhyme-BL), we first ...
11
Using Wikipedia for Automatic Word Sense Disambiguation
... Although Wikipedia provides the so-called dis- ambiguation pages that list the possible meanings of a given word, we decided to use instead the anno- tations collected directly from the Wikipedia links. This decision is ...
8
Separating the influences of prereading skills on early word and nonword reading
... reading words that can be recognized by sight versus reading nonwords that must be at least partially ...other words, it is not necessary for a child to master one phase before moving on to the ...some ...
19
Spirituality in Yayati Madan G Gandhi's The Rhyme of The Mystic Mariner
... The analysis of the selected poems from The rhyme of the mystic mariner focuses on such quality-oriented concepts as universality, phenomenology, human-baseness, numinousness[r] ...
21
Generating Topical Poetry
... Automated poem generation has been a popular but challenging research topic (Manurung et al., 2000; Gervas, 2001; Diaz-Agudo et al., 2002; Manurung, 2003; Wong and Chun, 2008; Jiang and Zhou, 2008; Netzer et al., 2009). ...
9
Wheatcroft and Whythorne’s ‘passports in rhyme’: place and proxemics in seventeenth century village performance
... If we compare Wheatcroft’s song with the aggression invited by provocative songs that we find in the Derbyshire legal records, it emerges as engaged in not dissimilar kinds of audience-b[r] ...
16
Mental suffering as a struggle with words: language and emotion
... experience can be both a source of frustration and joy. It is a pleasure to experience that we are capable of feeling and doing more than expressed by the language we use. It can, however, also be frustrating to ...
11
Geant-val: - a web application for validation of detector simulations
... • Should use the technologies that allows a fast feature development and integration. In order to keep data consistent between all application services a plot data type was in- troduced. A plot object is a central ...
6
Factor XIII Val 34 Leu polymorphism and migraine
... Genomic polymerase chain reaction (PCR) of the FXIII exon 2 gene was performed using the follo- wing primers: 5' gaccttgtaaagtcaaaaatgtc 3' and the mutagenic 5' tggtgcccggggcgtcaacctgcaag 3' (cor- responding to ...
5
Payload Capability of VAL- Quadrotor Based on PID Controller
... VAL-quadrotor in the presence of a controller can effectively improve the capability of payload about 40% of the standard quadrotor. While in the normal case (without carrying a load), VAL-quadrotor can ...
8
Gifted and Talented UCEA English
... Feminine Rhyme: a rhyme of two syllables in which the final syllable is unstressed ('mother | ...feminine rhyme the last, unstressed, syllable is usually not counted as one of the ten syllables in ...
13
Words that describe chronic musculoskeletal pain: implications for assessing pain quality across cultures
... state words, katakka and chasakka, are also associated with having “sudden” pain, although these words do not translate directly into “sudden” in ...state words have specific sensory qualities almost ...
10
Words that make pills easier to swallow: a communication typology to address practical and perceptual barriers to medication intake behavior
... barriers (r = − 0.254, P = 0.023 and r = − 0.249, P = 0.026, respectively). These findings indicate that the more nurses summarized information or used pictures to illustrate the information, the fewer concerns patients ...
15
The desoxazoline asidiacyclamide analogue cyclo(Gly–Thr–D Val–Thz–Ile–Thr–D Val–Thz) acetonitrile monosolvate
... Data collection: SMART Bruker, 1998; cell refinement: SAINTPlus Bruker, 1998; data reduction: SAINT-Plus; programs used to solve structure: SHELXS97 Sheldrick, 2008; programs used to ref[r] ...
11
Del Val
... The inspector found the provider had put appropriate arrangements in place to meet the needs of the residents proposed to be admitted to the centre, for example, an increase in staffing [r] ...
14