Top PDF Causes of visual loss in patients with uveitis

Causes of visual loss in patients with uveitis

Causes of visual loss in patients with uveitis

189 ranging and may cover the full range of clinical manifestations [575, 577, 579, 824]. The features of uveitis in the series by Towler were non-specific in that they could occur in association with other disorders, and were of no value in predicting the subsequent development, clinical type or course of MS, unlike the known association of asymptomatic peripheral periphlebitis with optic neuritis and its predictive value for a subsequent diagnosis of MS. They reported intermediate and posterior as the commonest types of uveitis[825]. Granulomatous uveitis has been noted to occur in MS patients[577] and attributed to MS when the typical diseases associated with granulomatous uveitis (tuberculosis, sarcoidosis and syphilis) have been excluded [826], and this has been hypothesised to be at least partly due to the disordered immunity occurring in MS [827]. Boskovich et al. [728] identifying the clinical features of intermediate uveitis and assessing its association with systemic diseases found that 7% of patients with IU had MS associated. Khairallah et al.[828] reported 2.3% of MS associated with IU. Following Rucker’s first report of the association of retinal periphlebitis with multiple sclerosis (MS) in 1944[829, 830], the observation has been confirmed by many other studies [831-833]. The reported incidence of retinal vascular sheathing has varied considerably in different series, from as low as 2% to 44%, but with an average of around 20%[834]. In the majority of patients the retinal vascular changes are not associated with symptoms and are not a threat to vision. In addition, the presence of peripheral retinal venous sheathing in individuals presenting with isolated optic neuritis has been shown to be predictive of the subsequent development of MS, with a relative risk of 14.4[825]. In this series, we report IU in 83% and the prevalence of MS among all cases of IU was similar to what reported in other series. Over the follow-up period, visual outcome was very satisfactory as only 1 eye developed visual loss of 6/18-6/36 due to macular damage and 1 eye developed severe visual loss due to optic atrophy. CMO was the main cause of visual loss in the Towler series. Better management options of this complication have been developed over the last decade, and this explains its absence from our study.
Show more

268 Read more

Degree, duration and causes of visual loss in uveitis

Degree, duration and causes of visual loss in uveitis

The retrospective, non-interventional observational survey was conducted with 315 consecutive patients attending a tertiary referral uveitis service. The mean duration of follow up was 36.7 months. Reduced vision (less than or equal to 20/60) was found in 220 of 315 patients (69.95%) with a subset of 120 patients having vision less than or equal to 20/200 unilateral visual loss occurred in 109 patients (49.54%) while 111 patients (50.45%) had bilateral visual loss. The mean duration of visual was loss was 21 months. Of the 148 patients with panuveitis, 125 (84.5%) had reduced vision, with 66(53%) having vision < 20/200. Main causes of visual loss was cystoid macular edema (CMO) in 59 of 220 patients (26.8%), cataract in 39 patients (17.7%), and a combination of CMO and cataract in 44 patients (20%). The following were predictors of a poorer visual prognosis - panuveitis, bilateral inflammation, increasing duration, Indian or Pakistani ethnic background and increasing patient age.
Show more

106 Read more

Clinical Patterns and Causes of Posterior Uveitis in a Tertiary Referral Eye Center in Northwest of Iran

Clinical Patterns and Causes of Posterior Uveitis in a Tertiary Referral Eye Center in Northwest of Iran

uveitis in Tehran (9). In a study designed by Rahimi and Mirmansouri in Shiraz, the most common causes of posterior uveitis were toxoplasmosis (42.1%) and Behçet’s disease (15.7%) (4). According to European and the Middle East studies, toxoplasmosis Was also the most frequently reported cause of posterior uveitis in Amsterdam (23), Italy (24) and Saudi Arabia; for example, in a recent study in Saudi Arabia, toxoplasmosis (46%) was the most common cause of posterior uveitis (16). In the same vein, in another study in Saudi Arabia, toxoplasmosis (56.9%) and presumed tuberculous uveitis (23.1%) were also the most frequent posterior uveitis cases (8). The incidence of toxoplasmosis as the main cause of posterior uveitis showed a large variation in the ranges of 38.3% to 90.7% in different studies (3,7,8,16). In addition, Toxoplasma was the main cause of posterior uveitis in Tunisia and Egypt (7,14). Similarly, it was the main cause of infectious uveitis in Iraq (17). In a recent study in Turkey, Toxoplasma and herpetic uveitis were also found to be the most common infectious type of uveitis (25). In a study carried out by Ghavidel et al, Toxoplasma gondii was also the most common pathogen of infectious uveitis in children (26). In addition, in another study carried out on children in Iran, toxoplasmosis and toxocariasis were the most prevalent infectious uveitis (10). The JIA (juvenile idiopathic arthritis) and toxoplasmosis have been reported to be the main forms of uveitis in children in Turkey (27). However, tuberculosis was the major cause of infectious uveitis in children in north India (28). In the present study, 84.2% of the patients had non-granulomatous posterior uveitis. Generallynon-granulomatous uveitis occurs more than granulomatous in all types of uveitis (2,3). An associated systemic disease was found in 20.8% of the patients in this study. Behçet (8.3%), VKH (4.2%), and TB (3.3%) were the most frequent systemic diseases. In this study, the frequency of complications in each etiologic group was evaluated. Macular scar had the highest incidence (15%) followed by the macular edema (5.8%). Moreover, 18.3% of the active toxoplasma retinochoroiditis lesions were found to be located in macular areas. According to this finding, a large proportion of patients with posterior uveitis had macular toxoplasmosis and severe and permanent visual loss because of the resultant macular scar. It is well established that most cases of ocular toxoplasmosis are acquired (29). About 2% of infected people with T. gondii in the United States may have ocular involvement which is even more probable in other countries such as Brazil (29,30). Development of an effective vaccine for cats (as the definitive host that excrete millions of oocysts after ingesting bradyzoite or tissue cyst) and assessing its implementation is a research priority (31).
Show more

5 Read more

Mechanisms of visual loss in papilledema

Mechanisms of visual loss in papilledema

optic nerve structure, it can be useful in the long-term fol- low-up of patients with papilledema. 30 Pathophysiology of Papilledema Although the definitive pathogenesis of papilledema in response to increased ICP remains unclear (Fig. 1), the pre- vailing theory is that papilledema is primarily a mechanical nonvascular phenomenon. 28,82 A successful theory should be able to explain the occurrence of transient visual obscu- rations, swelling localized to the optic disc, venous disten- sion, absence of spontaneous venous pulsations, and rela- tive sparing of the papillomacular bundle. 81 The severity of papilledema is related to the ICP increase, but may not cor- relate directly with the level of ICP because the communi- cation of CSF pressure between the optic canal and the intracranial space depends on an open CSF space sur- rounding the optic nerve, 76 which varies in width from patient to patient. Increased ICP in the optic nerve sheath produces axoplasmic flow stasis in the optic disc with sub- sequent swelling of the axons. This manifests as early papilledema and secondarily causes changes in the other optic disc as wll as retinal vascular changes associated with papilledema. This phenomenon was experimentally repro- duced by direct ligation of the optic nerve, and the use of intracranial balloons to cause increased ICP 82 or by induced ocular hypotension. 77
Show more

8 Read more

Patterns of uveitis in children according to age: comparison of visual outcomes and complications in a tertiary center

Patterns of uveitis in children according to age: comparison of visual outcomes and complications in a tertiary center

Demographic data pertaining to patients and their disease were collected. These parameters included: age, gender, age at first episode, delay time in referral to our uveitis center (calculated as the time between initial symptoms and first presentation to our center), number of attacks, total time of follow up, number of visits, laterality, chronicity and distri- bution of the disease, etiology, systemic association, best corrected visual acuity at first and last visit as well as at 6 months and 1 year, intraocular pressure measured by Tono- pen or applanation tonometry, different types of ocular and systemic treatments used, ocular surgeries performed and the different types of ocular complications and the date of their occurrence. Complications included cataract, ocular hypertension defined as IOP > 21 mmHg (labeled glaucoma when associated with optic nerve damage), amblyopia – de- fined as vision worse than 20/30 or 2 lines interocular dif- ferences only after affirming control of inflammation and any organic cause of visual loss, cystoid macular edema (CME), posterior synechiae and band keratopathy. Al- though vasculitis, papillitis and vitreal haze are manifesta- tions of inflammation, we listed them under complications due to their vision threatening risk. We recorded the most significant cause of visual loss for each eye, selecting the more severe cause whenever more than one existed. Uveitis was assessed with a detailed questionnaire on medical his- tory, family history and exposure status and then by a full eye examination and targeted laboratory investigation to diagnose inflammatory and infectious etiologies. All pa- tients are investigated with complete blood count (CBC), Serum Glutamic Pyruvic Transaminase (SGPT), Serum Glutamic Oxaloacetic Transaminase (SGOT), creatinine, urine analysis, Purified Protein Derivative (PPD), Venereal Disease Research Laboratory (VDRL), Treponema Pallidum Hemagglutination Assay (TPHA), and Anti-Nuclear Anti- body (ANA). Further investigation is targeted as per history and exam as follows: Infectious etiologies were detected through various tests including PPD, viral antibodies, toxo- plasma antibodies, and Polymerase Chain Reaction (PCR). Autoimmune causes were detected by tests investigating
Show more

8 Read more

Causes of uveitis in children without juvenile idiopathic arthritis

Causes of uveitis in children without juvenile idiopathic arthritis

This was a retrospective, observational study of all pediatric uveitis patients seen in the Department of Ophthalmology at the University of Virginia. The study was approved by the institutional review board and was conducted in accordance with the principles of the Declaration of Helsinki. A data- base of all patients with a diagnosis of uveitis is maintained by the Department of Ophthalmology at the University of Virginia. The database was reviewed to identify patients diagnosed with uveitis and aged 0–18 years over a 30-year period from 1984 through 2014. Thirty-nine pediatric uveitis patients were identified from the database. No minimum follow-up period was required for inclusion, and all data in the database were collected from patient charts completed at the time of patient visit. Time points for data collection in the database included each patient’s initial visit to the clinic (baseline) and final follow-up visit. Disease classification was recorded in accordance with the Standardization of Uveitis Nomenclature Working Group criteria. 9 As there were vari-
Show more

8 Read more

Clinical and visual outcomes of patients with uveitis in the mid-Atlantic United States

Clinical and visual outcomes of patients with uveitis in the mid-Atlantic United States

Results: The study included 644 eyes of 491 patients. Patients with mild visual loss (logMAR 0.4) at presentation were younger than those with severe visual loss (SVL, logMAR 1.0) (P=0.002). Females were more likely to have mild visual loss as compared to males (P=0.025). Median overall BCVA was logMAR 0.18 at initial and final presen- tation (P=1.00). Vision loss at diagnosis was a predictor for moderate visual loss (MVL, logMAR 0.4 to 1.0) to SVL at last follow-up (P0.001). Eyes with ocular hypertension were positively associated with MVL and SVL as compared to normotensive eyes (1.89 times at baseline, 2.62 times at last follow-up). Median BCVA was 0.18 logMAR for the anterior uveitis (AU) and 0.48 logMAR for the non-AU patients (P0.001). AU patients were less likely to have SVL than non-AU group (P0.001). AU group received local corticosteroids more frequently and systemic corticosteroids less commonly than non-AU patients (P0.001). AU patients with MVL to SVL were more likely to have ophthalmic surgery (cataract, glaucoma or pars plana vitrectomy [PPV]) than those without MVL or SVL (P0.001). Non-AU patients with MVL to SVL were more likely to have PPV than those without MVL or SVL (P=0.001).
Show more

10 Read more

Analysis of visual function and quality of life in patients with uveitis

Analysis of visual function and quality of life in patients with uveitis

Uveitis,an inflammatory disease of the uveal tract(iris, ciliarybody, choroid) of the eye. Uveitis are vision threatening condition which are relatively under appreciated by the general practioniares and comprehensive ophthalmologists.Few people realise,Uveitis are responsible for leading cause of blindness in developed countries and one of the cause of preventable blindness in developing countries like India.The maximum incidence occurs in 25-50 years age group(working age),the visual impairment in this age group causes economic consequences.
Show more

159 Read more

Clinical course and visual outcome in patients with diabetes mellitus and uveitis

Clinical course and visual outcome in patients with diabetes mellitus and uveitis

infective cause. This included a full laboratory workup with full blood count, erythrocyte sedimentation rate, urea and electrolytes, liver function tests, C-reactive pro- tein, angiotensin converting enzyme, anti-nuclear anti- body, anti-neutrophil cytoplasmic antibody, syphilis serology and a chest x-ray. Additional investigations, such as toxoplasma antibodies and Mantoux test were undertaken where clinically indicated. Classification and grading of uveitis was undertaken according to the Standardization of Uveitis Nomenclature (SUN) Working Group classification [4]. The clinical course of the uveitis, frequency of recurrence and treatment undertaken were documented. The type of DM, DM treatment, changes in the DM treatment, types of diabetic retinopathy and maculopathy and its course and treatment were noted. Visual acuities and causes for poor vision were recorded. Where available HbA1c values throughout the clinical course were documented and compared with either ac- tive or quiescent uveitis.
Show more

6 Read more

Evaluating the Impact of Uveitis on Visual Field Progression Using Large Scale Real-World Data

Evaluating the Impact of Uveitis on Visual Field Progression Using Large Scale Real-World Data

An important finding is the worse presenting MD in the uveitic group, suggesting early VF loss may be under- detected. Additionally, the baseline age in the uveitis plus glaucoma group was younger, which also supports the hypothesis that uveitic glaucoma may progress faster. Detecting early VF loss is clinically difficult if perimetric testing is not performed routinely, particularly in the absence of a deranged IOP. In the context of uveitis, con- trolling the inflammation may require more clinical ur- gency and early glaucomatous damage can be easily overlooked. On the other hand, anti-inflammatory treat- ment, of which corticosteroids are the preferred first-line agent, can precipitate raised IOP in up to a third of pa- tients. 33,34 Steroid implants have been shown to increase the risk of developing glaucomatous optic neuropathy by 4 times compared to those taking systemic therapy. 35 A comparison of VF progression in uveitis patients receiving steroid treatment vs those without would be of interest for future studies. Such an analysis would require accurate data on frequency, duration, and formulation of steroid use, which is not routinely captured by the Medisoft EMR. Suc- cessful management of glaucoma in uveitis requires simul- taneous treatment of inflammation and IOP elevation. In some cases, controlling the inflammation also helps to reduce IOP and there is evidence to suggest those treated with aggressive anti-inflammatory therapy have better out- comes. 6 Antiglaucomatous drugs such as beta-blockers and
Show more

8 Read more

Immunohistochemical study of epiretinal membranes in patients with uveitis

Immunohistochemical study of epiretinal membranes in patients with uveitis

Epiretinal membranes (ERM) are fibrocellular prolifera- tions over the internal limiting membrane that can lead to significant macular pathology when associated with contraction [1]. When these membranes contract, patients often complain of metamorphopsia and loss of visual acuity. Early histopathologic studies characterized ERMs from a variety of diseases; however, immunohis- tochemical studies were not performed [2, 3]. While there is little understanding as to how idiopathic ERMs form, there is even less information regarding the for- mation of ERMs in chronic uveitis. To better understand the formation of these membranes, we aim to character- ize the immunohistochemistry of ERMs from two patients with chronic idiopathic uveitis.
Show more

6 Read more

Loss of ARHGEF1 causes a human primary antibody deficiency

Loss of ARHGEF1 causes a human primary antibody deficiency

Identification of an ARHGEF1 deficiency. WES of DNA from total blood samples from both patients was performed with a view to identifying the underlying genetic cause of their disease. The WES results of both siblings were compared, leading to the identifica- tion of compound heterozygous variants in ARHGEF1: a nonsense variant on Chr19: 42398710: C>T (hg19 build 137) (NM_199002.1, exon 12, c. 898 C>T, p.R300X) and a splice acceptor site variant on Chr19: 42406933: G>T (Figure 3). Both variants (confirmed by Sanger sequencing; Figure 3B) were predicted to be highly damag- ing for the corresponding protein function, with combined anno- tation-dependent depletion scores of 41 and 23.3 for the nonsense and splice acceptor site variants, respectively. These variants were not annotated in our in-house database or in several open-access human genetic variation databases, including the Exome Aggre- gation Consortium (ExAC), the Exome Sequencing Project, the Short Genetic Variations Database (dbSNP), and the Swiss-Prot Overall, the patients’ clinical and immunological characteris-
Show more

15 Read more

Causes of Deceased Donors Loss before Organ Retrieval

Causes of Deceased Donors Loss before Organ Retrieval

criteria, were observed more in lost donors. The findings regarding high mortality rate of ICU hospitalized patients with organ failure is not new (20-22). In our insight, donors with single transplantable organs are more prone to irreversible cardiac arrest and loss. The fact defines need for more prompt management protocols for these potential donors.

5 Read more

Global Loss of Coastal Habitats Rates, Causes and Consequences

Global Loss of Coastal Habitats Rates, Causes and Consequences

These results show that most Spanish coastal seagrass meadows have been declining over the present decade. The rate of decline of P. oceanica meadows is currently 5% per year, slightly lower than that of corals—the marine ecosystem undergoing the fastest decline—and higher than the global loss rate of marshes and mangrove forests (Duarte et al. 2008). This places P. oceanica meadows among the most threatened marine ecosystems on the planet. The general decline observed recently in Spanish coastal seagrass meadows may not have begun so recently, however. A retrospective demographic analysis of 27 P. oceanica meadows on the Spanish coast showed that 80% of them were already declining between 1967 and 1992 (Marbà et al. 1996). And the scale of their decline in the present decade is similar to in the past. This suggests that, over the last four decades, either (1) the same pressures have continued bear- ing down on seagrass meadows, or (2) a succession of different pressures have brought about a comparable rate of decline.
Show more

32 Read more

Loss of the sphingolipid desaturase DEGS1 causes hypomyelinating leukodystrophy

Loss of the sphingolipid desaturase DEGS1 causes hypomyelinating leukodystrophy

Biallelic deleterious variants of DEGS1 in patients with brain white matter abnormalities. As part of our ongoing studies on the molec- ular basis underlying undiagnosed leukoencephalopathies, we identified a total of 19 individuals from 13 unrelated families with rare variants suspected to alter DEGS1 function (Figure 2 and Tables 1, 2, and 3). The first patient under investigation was a female who presented feeding difficulties since birth, extreme irritability, hypertonia with opisthotonus, and nystagmus, result- ing in death at 18 months. Severe hypomyelination was observed in the central and peripheral nervous system in the MRI and nerve conduction studies (patient 6, Tables 1 and 4). Extensive diagnostic investigations were negative. We thus carried out WES (see Methods) in the proband, with subsequent Sanger val- idation and segregation analysis (Supplemental Figure 1; sup- plemental material available online with this article; https://doi. org/10.1172/JCI123959DS1). We identified a homozygous frame- shift variant in DEGS1 (GenBank ID, NM_003676.3; c.604delT; p.[Tyr202Thrfs*8]; http://www.ncbi.nlm.nih.gov/genbank/) that was not present in the genome aggregation database (GnomAD; >246,000 chromosomes; http://gnomad.broadinstitute.org/), the NHLBI Exome Variant Server (EVS; >13,000 alleles; http://evs. gs.washington.edu/EVS/), or the Exome Aggregation Consortium (ExAC) database (>60,706 individuals; http://exac.broadinstitute. org/). No homozygous loss-of-function (LoF) variants were pres- ent for this gene in these databases. Personal communication with international Reference Centers for Leukodystrophies and infor- mation exchange on the GeneMatcher (https://genematcher.org/) (21) platform facilitated the identification of 18 additional affected individuals with DEGS1 variants from various ethnic backgrounds who displayed overlapping phenotypes. These variants were pres- ent in a homozygous or compound heterozygous manner in 13 families and segregated in the recessive inheritance mode. Con- sanguinity was present in 2 out of 3 of the families. All consanguin- eous families harbor a homozygous variant except family 9.
Show more

18 Read more

In-bag dislocation of intraocular lens in patients with uveitis: a case series

In-bag dislocation of intraocular lens in patients with uveitis: a case series

A 45-year-old Caucasian male presented with right eye cataract secondary to previous bilateral uveitis in 2008 at the age of 39. Background history includes type 2 diabetes diagnosed in 2011. Ocular history included herpetic kera- touveitis with bilateral acute retinal necrosis diagnosed in 2006 (now quiescent) and bilateral relapsing remitting macular oedema treated with multiple IVTA injections. His preoperative right eye vision was counting fingers, and he underwent an uncomplicated phacoemulsification with a 19.0D Alcon SN60WF PCIOL inserted into the bag. Postoperatively, the patient continued to have intermittent severe macular oedema and received three further right eye IVTA injections between 2008 and 2013. His right eye vision has improved to 6/9 by February 2013; however, some right eye PCIOL dislocation was noted. Sixty-four months after his initial PCIOL implant, the patient was found to have right eye in-bag PCIOL dislocation and a vision of 6/24 −1 in June 2013. Two months later, he underwent a right-sided anterior approach IOL extrac- tion and secondary anterior chamber IOL implantation. On last review, his right eye vision was 6/36.
Show more

8 Read more

Coinfections and differential diagnosis in immunocompetent patients with uveitis of infectious origin

Coinfections and differential diagnosis in immunocompetent patients with uveitis of infectious origin

AH and/or vitreous fluid, blood and serum samples were collected from consecutive patients suspected of having uveitis of infectious origin at presentation. The diagnosis of OT was confirmed by serum titers, quantification of antibodies with the GWC and by detection of Toxo- plasma gondii genomes with PCR. Differential diagnosis by PCR in AH was done for viral origin and Mycobacter- ium tuberculosis. AH samples (0.1 to 0.2 ml) were ob- tained at the Ophthalmologic Center, Clínica Barraquer, in a surgery room, under sterile conditions after topical anesthesia, and were sent to a laboratory for analyses. For real-time PCR (qPCR) assays, DNA extraction was performed using the QIAamp DNA Mini Kit (Qiagen, Hilden, Germany) and procedures were performed as recommended by the manufacturer. DNA from a pellet of AH was obtained by incubating samples for 10 min at 56 °C with the cell lysis solution. After centrifuging at 6000 g for 1 min at 37 °C, flow through was discarded and the spin column was recovered. A two wash step was performed with washing solution and the cellular proteins were then eluted from the spin column. To detect Toxoplasma DNA in AH (0.1 to 0.2 ml), a qPCR TaqMan-based assay was used for this study, as de- scribed previously [19]. Briefly, this test amplifies a 100-bp of a 529-bp repetitive fragment (RE) that is re- ported to be repeated 300 times in the genome of T. gondii (Genebank accession number AF146527). The TaqMan probe TACAGACGCGATGCCGCTCC, and RE primers F- GCCACAGAAGGGACAGAAGT and R- ACCCTCGCCTTCATCTACAG, were redesigned using web-based software (found at https://www.genscript. com/ssl-bin/app/primer). The Taqman probe was labeled at the 5’with 6-carboxyfluorescein (FAM) and at the 3′ with non-fluorescent quencher. qPCR was performed using a Platinum® Quantitative PCR SuperMix-UDG (Invitrogen, Carlsbad, California, United States). The amplification protocol consisted of two initial stages of 50 °C for 2 min, held for UDG incubation, and 95 °C for 2 min, held for UDG inactivation, followed by 40 cycles of 95 °C for 15 s of denaturation, followed by 60 °C for 30 s of annealing and extension. The positive control was DNA from the RH strain and the negative control was distilled water in the presence of primers. Control for contamination during DNA extraction was also in- cluded and consisted of a tube without a template but containing all reagents for DNA extraction and filled with the same pipette. An additional control was a blood sample from a patient that tested negative for Immuno- globulin G (IgG) and Immunoglobulin M (IgM) Toxo- plasma antibodies.
Show more

10 Read more

Effect of gingival inflammation on the inflammatory response in patients with idiopathic uveitis

Effect of gingival inflammation on the inflammatory response in patients with idiopathic uveitis

Introduction Uveitis is an inflammatory disease involving the pigmented vascular coat of the eyeball (iris, ciliary body and choroid) and is a major cause of severe visual impairment with the 10-15 % of total blindness and its incidence in the USA was reported as 52.4/100.000 people per year (Gritz and Wong, 2004). Idiopathic uveitis (IU) is an isolated type of autoimmune uveal inflammation that may occur without any accompanying autoimmune mediated diseases. It has recently been shown that Th17 cells and interleukin-17 (IL-17) may have an important role in the pathogenesis of the IU (Sun et al. 2015) and the inflammatory process is mainly driven by Th17 cells and is sustained by pro-inflammatory cytokines such as, tumour necrosis factor-alpha (TNF-α), IL-10, IL-1β and IL-6 (Selmi, 2014). IL-17 is potentially an important mediator in periodontal immunopathology due to its pro-inflammatory and bone resorptive activities and furthermore, it has been demonstrated that, IL-17 producing cells are related to severity of gingival inflammation (Cheng et al., 2014). Gingivitis is a very common chronic inflammatory status of the periodontium, in which oral microbiota is the primary etiological factor (Colombo et al., 2009). High levels of IL-17A were reported in gingival crevicular fluid (GCF) of periodontitis patients (Vernal et al., 2005). Consequently, in patients with periodontitis, the association of the increased GCF levels of IL-17 and the presence of
Show more

26 Read more

Perioperative visual loss in ocular and nonocular surgery

Perioperative visual loss in ocular and nonocular surgery

We searched the National Library of Medicine’s PubMed database with a subsequent review of the accompanying references (last accessed February 8, 2010). The major search words and word combinations included: posterior ischemic optic neuropathy; anterior ischemic optic neuropathy; central retinal artery occlusion; pituitary apoplexy; cortical blindness; optic nerve trauma; postoperative vision loss; postoperative blind- ness; perioperative vision loss; perioperative blindness; and ocular surgery. In addition, the citations from the above searches were also included. Cases from the non-English literature and cases prior to 1970 were not included. Cases with documented direct surgical trauma to orbital structures other than the optic nerve were not included.
Show more

16 Read more

Characterization of serous retinal detachments in uveitis patients with optical coherence tomography

Characterization of serous retinal detachments in uveitis patients with optical coherence tomography

In this study, we identified SRDs in 15 % of all patients with uveitis who underwent time-domain OCT imaging due to suspected macular pathology. Intermediate and panuveitis were the most common anatomic sites of inflammation, which is consistent with prior research evaluating uveitic macular edema [1]. Moderate or severe visual impairment was identified in 71 % of patients in this series. We also found that increased CST was correlated with poorer log- MAR visual acuity in patients with SRD. Whether de- creased vision was a direct result of the SRD is difficult to ascertain due to high prevalence of concurrent intraretinal macular edema, which may also cause reduced visual acuity. Other factors including photoreceptor integrity, presence or absence of foveal atrophy, and chronicity of macular edema likely contributed to visual impairment, but these factors were not specifically addressed in the context of this study. Diffuse macular edema and focal cystoid macular edema were the OCT features most commonly associated with SRD. The focal subtype of macular edema was most com- monly identified while the diffuse subtype was also seen in a large proportion of patients. Patients with intermediate Fig. 2 OCT and macular
Show more

7 Read more

Show all 10000 documents...