18 results with keyword: 'fraudulent corporate signals conduct as securities fraud'
Compared to verbal disclosures, deceptive signals are underen- forced by federal securities laws—a practice that affects the way in which managers commit fraud. 159 Consequently,
N/A
Yao Li and Paige Ng Statistical Analysis and Forecasting Solar Radiation in Arizona WINONA STATE UNIVERSITY 15 active weather stations have complete. data for 17 years from 1999 to
N/A
Elements of a Hydrologic Ensemble Prediction System Ensemble Pre-Processor Parametric Uncertainty Processor Data Assimilator Ensemble
N/A
This gives rise to the familiar phrase “off balance sheet financing.” As operating leases are used in the airline industry to a significant degree, capitalizing them to the
N/A
Had it done so, the CFA would have found exactly what GEICO, other insurers and the Maryland Insurance Administration found—that occupation and education are not only
N/A
• No one is using the database at the time the upgrade is being applied • All PCs running the application are upgraded.. • The database is
N/A
This section will contain all various publications, including reports and other similar resources prepared by Copenhagen Centre on Energy Efficiency, and collaborative or
N/A
Abstract—The weighted geometric mean ordering vector and logarithmic least squares are proposed to aggregate information of decision makers to generate weight vector from uncertainty
N/A
Processed ± the number of DataDirector answer documents recognized Approved ± the number of answer documents ready to commit to DataDirector. The summary also indicates
N/A
S˘ al˘ agean, Subclasses of univalent functions, Complex Analysis—Fifth Romanian-Finnish Seminar, Part 1 (Bucharest, 1981), Lecture Notes in Math., vol. Owa, Convolution properties of
N/A
AGGAGTCTGACTGACCATTGGACTAGGGGATTGACCAGTAGGCTGCGATTCGGATGCGGATTGACGAT TAAA AAGGATTACGATTAGCTGT GACGTG
N/A
some of the non-HLA loci associated with this vasculitis using candidate-gene approaches were replicated in different populations ( 66 – 71 ) and, therefore, they represent
N/A
Final Regulations - For charitable remainder annuity trusts or fixed percentage unitrusts, the Annuity or Unitrust Amount may be paid within a reasonable time after the close of
N/A
o For Non-European students, a you’ll need to subscribe to one of the two compulsory student insurance plans provided by the University (a total sum of €211 to be
N/A
Please note that these features are only available for payments made via a Customer Initiated Payment Account (Direct Debit).. However you can also future date a BPay or EFT
N/A
Modified Aberdeen shape in cardinal red, fully lined with University brocade but with a 64mm band of pale blue ribbon on lining, rebated 25mm from the outside edge of the
N/A
Consideration and ACTION to approve a sign grant for Omar Rocha's Plaza located at 741 W Ocean Blvd.. Milum introduced the application to
N/A
“People throw away data because they don’t understand the value of it – it’s a shocking thing in 2015.” Even if it’s unclear what your organisation will do with it,
N/A