[PDF] Top 20 Intestinal, but not hepatic, ChREBP is required for fructose tolerance
Has 10000 "Intestinal, but not hepatic, ChREBP is required for fructose tolerance" found on our website. Below are the top 20 most common "Intestinal, but not hepatic, ChREBP is required for fructose tolerance".
Intestinal, but not hepatic, ChREBP is required for fructose tolerance
... Slc2a5 ChREBP binding site: forward — GGGACTGAGAAACATCCGGG, reverse — TGTTGCCCAAGGTGCT- GATA; Slc2a5 negative control: forward — TAATCCTTCCCACGGCGTTT, reverse — CCATAGGC- CAAGCTTCCAGT; Pklr ChREBP binding ... See full document
14
Divergent effects of glucose and fructose on hepatic lipogenesis and insulin signaling
... without fructose- or glucose-supplemented ...between fructose and glucose ...with fructose developed more pronounced obesity, glucose intolerance, and hepatomegaly as compared to glucose-supplemented ... See full document
17
ChREBP regulates fructose induced glucose production independently of insulin signaling
... of fructose, but not glucose, to acutely activate ChREBP in vivo is likely due to differences in how the intact liv- er metabolizes these 2 simple ...first-pass hepatic metabolism due in part to ... See full document
16
Targeting soluble tumor necrosis factor as a potential intervention to lower risk for late-onset Alzheimer’s disease associated with obesity, metabolic syndrome, and type 2 diabetes
... decreases hepatic LCN2 in the presence of diet-induced insulin impairment and liver inflammation LCN2 is a downstream TNF inflammatory molecule as- sociated with hepatic steatosis and insulin insensitivity ... See full document
16
41FH5015E 01B M2247E M2248E M2249E Disk Drives Engineering Specification Dec89 pdf
... Tape Drive Format Speed Tolerance Gap Required Track Offset Tolerance Gap Required Data strobe Offset Option Available Rotational Speed Tolerance >0.5% Transfer Rate >10 MHz Transfer Rat[r] ... See full document
59
Carcinomas of the small intestine in sheep : a thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy at Massey University
... signifi cant positive re lationships ( Table XVIII ) . �ltiple regression te chnique s showed there was a signi ficant relationship between both sheep and cattle sto cking rates per acre and t he incidence of sm�ll ... See full document
352
Transepithelial d glucose and d fructose transport across the American lobster, Homarus americanus, intestine
... MS fructose transport lower in animals in the autumn/winter but also there was no apparent trafficking of phloretin-sensitive GLUT2-like transport proteins to the mucosal membrane during cold months ...GLUT5 ... See full document
8
Basis for the control of purine biosynthesis by purine ribonucleotides
... into hepatic purine nucleotides documenting an increase in the rate of purine biosynthesis in the liver of fructose-treated ...the fructose, but not the glucose-treated animals, there was a reduction ... See full document
10
Nonalimentary Fructosuria
... Both oral and intravenous fructose tolerance tests gave results entirely within nor- mal limits. Ingestion of glucose or lactose and[r] ... See full document
5
LRH 1–dependent glucose sensing determines intermediary metabolism in liver
... of hepatic carbohydrate fluxes were performed as described previously (46, ...respectively. Hepatic triglyceride content was quantified after lipid extrac- tion (48) using an enzymatic assay ...these ... See full document
11
Antidiabetic Effect of Diasansar in Streptozotocin and Fructose Induced Type-2 Diabetes in Rats
... Type-2 diabetes was induced by injecting to the 2 day old wistar rat pups (either sex) with 90 mg/kg, b.wt. of streptozotocin, intraperitoneally. At 12 Weeks of age, all the animals were screened for oral glucose ... See full document
8
Resveratrol effect on fructose induced nash: A mechanistic approach
... high fructose diet it prevented the gain in body weight and modulated the severity of liver damage seen microscopically and relieved the development of ...reducing hepatic lipid deposition, prevented lipid ... See full document
10
Succinic Acid Monoethyl Ester and Metformin Regulates Carbohydrate Metabolic Enzymes and Improves Glycemic Control in Streptozotocin-Nicotinamide Induced Type2 Diabetic Rats
... Metformin is an oral hypoglycemic agent, which be- longs to the class known as the biguanides. Chemically it is N-N dimethylimidodicarbonimidic diamide [13]. Metformin is now widely used as one of the mainstays in the ... See full document
6
Hypoglycaemic Activity of Tissue cultured and Field grown Plants of Tinospora cordifolia
... 2.5. Media composition and culture conditions For all the above studies, MS medium were used as sole basal medium. Four individual stock solutions viz., Macro, Micro, Fe, EDTA and Vitamins were prepared and stored in ... See full document
12
Th17/Treg homeostasis, but not Th1/Th2 homeostasis, is implicated in exacerbation of human bronchial asthma
... Patients with diagnosed asthma attending the Third-Affiliated Hospital of Sun Yat-sen University, China, were recruited in the study between December 2016 and May 2017 based on the diagnostic criteria of the Global ... See full document
10
Fructose-rich diet leads to reduced aerobic capacity and to liver injury in rats
... The exercise is an important and powerful weapon against the metabolic syndrome markers. The minimal lactate zone is situated in a transition domain between intense and severe exercise. In this zone, both glycolytic and ... See full document
9
Fructose impairs glucose-induced hepatic triglyceride synthesis
... dietary fructose has been associated with hypertriglyceridemia and insulin resistance, primarily of hepatic origin, the aim of this study was to evaluate the effects of fructose on hepatic ... See full document
10
A COMPARISON OF THE METABOLISM OF FRUCTOSE AND GLUCOSE IN HEPATIC DISEASE AND DIABETES MELLITUS
... The rise in blood lactate, pyruvate and ketoglutarate is much greater and more rapid with fructose than with glucose, and is of similar degree in normals, diabetics, and patients with li[r] ... See full document
11
Original Article Different dietary contribution to hepatic inflammatory and lipogenic factor mRNA expression
... establish NASH in a rat model by increasing fatty acid intake causing hepatic lipid accumu- lation and ROS. Free fatty acid products and LPS can induce release of downstream inflam- matory factors which occur in ... See full document
9
The lipogenic transcription factor ChREBP dissociates hepatic steatosis from insulin resistance in mice and humans
... via ChREBP overexpression had clear beneficial effects on both hepatic insulin signaling and glucose ...conditions. ChREBP overexpression induced hepatic steato- sis with a greater ... See full document
20
Related subjects