Top PDF BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

Lab12Dis2 27 Male day 2 after vaccination Lab12Dis3 25 Male day 2 after vaccination Lab12Dis4 25 Male day 2 after vaccination Lab12Dis5 26 Male day 2 after vaccination Lab12Dis6 29 Male [r]

13 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

al., 1992 42 Not standard TENS – Codetron Evaluated ‘acupuncture-like stimulation’ for chronic pain syndrome or osteoarthritis using a Codetron device Fary et al., 2011 43 Not standard TENS - subsensory pulsed electrical stimulation Evaluated pulsed electrical stimulation for osteoarthritis of the knee using a commercially available TENS stimulator (Metron Digi-10s) that was modified by a biomedical engineer to deliver pulsed, asymmetrically biphasic, exponentially decreasing waveform currents with a frequency of 100 Hz and pulse width of 4 msec. Author’s state “ Participants attached the device and turned the intensity up until they could feel pins and needles or a prickling sensation under one or both electrodes. After achieving sensory output, participants were instructed to turn the intensity down until they could no longer feel any electrical stimulation. At this stage, a built-in locking mechanism was engaged that prevented subsequent adjustment of intensity without restarting the device.” Thus, subsensory stimulation.
Show more

21 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

Supplementary Table 1: Characteristics of the 488 individuals with ovarian cancer included in this investigation. Of the 488 patients, 266 were enrolled at primary diagnosis of ovarian cancer and 222 were enrolled with recurrent ovarian cancer. Supplementary Table 2: Rare germline variants in the BRCA1 and BRCA2 genes observed in 488 OC patients. For each variant, the results of paired NGS analyses of the DNA sample derived from blood and the DNA sample derived from the corresponding tumour are shown, i.e. the number of reads showing the variant allele and the number of reads showing reference allele.
Show more

11 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

16S rRNA Gene Amplicon Sequencing: DNA extracted from the EUS acquired specimens [2 (1-5) ng/µL] was evaluated for taxonomic profiling via 16S rRNA gene amplicon sequencing by the University of Minnesota Genomics Center for bacterial rRNA amplification and sequencing, using methods previously published, selecting the V4 region of the 16S rRNA gene using primers Meta_V4_515F (5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA -3’) and Meta_V4_806R (5’-

9 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

Lite peaches canned with no added sugar (artificial sweetener). Lite peaches canned with no added sugar (artificial sweetener)[r]

20 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

D&C kit and/or MVA; Functional suction apparatus for use with catheter and/or manual suction device for fluid extraction; Self-inflating bag and newborn masks (size 0 and size 1) for resuscitation; Resuscitation table/trolley with light source; Electricity available at all times when facility was open in last 7 days and/or back-up energy source; Private delivery room or visual privacy ensured in delivery area; Newborn corner;

26 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

14. Posner K, Brown GK, Stanley B, Brent DA, Yershova KV, Oquendo MA, et al. The Columbia–Suicide Severity Rating Scale: initial validity and internal consistency findings from three multisite studies with adolescents and adults. Am J Psychiatry. 2011 Dec;168(12):1266–77. 15. Viguera AC, Milano N, Laurel R, Thompson NR, Griffith SD, Baldessarini RJ, et al. Comparison of electronic screening for suicidal risk with the Patient Health Questionnaire Item 9 and the Columbia Suicide Severity Rating Scale in an outpatient psychiatric clinic. Psychosomatics. 2015 Oct;56(5):460 –9.

9 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance

Central and local council budget allocations for eye health in decentralised systems Percent of government health budget spent on outpatient vs inpatient eye care Is user fee revenue generated from eye care ring-fenced for eye health at facility and district level? (Y/N) Proportion of annual national expenditure on eye care medicines by government budget, donors, charities and private patients Share of population eligible for a defined set of eye health care goods and services funded under public programmes.

8 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance. Zero Ebola Campaign

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance. Zero Ebola Campaign

• Illustrative quotes from SMAC Community Mobilisers, Religious Groups, and Partner Radio Stations involved in the Zero Ebola Campaign.. “People were asking for food items, soap, with[r]

21 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this

Additional discussion Threshold of ≤8 NIHSS points at 24h postintervention As the threshold with the highest predictive value for long-term functional independency (mRS 0-2) the NIHSS ≤8 points at 24h postintervention, logically, represents a group of patients with individual and procedural variables that are each for themselves and even more in combination most responsive for a net beneficial treatment effect.

7 Read more

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this

BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this

Abbreviations: CAD = coronary artery disease; MI = myocardial infarction; PCI = percutaneous coronary intervention; CABG = coronary artery bypass grafting; TIA = transient ischemic atta[r]

15 Read more

Important notice: The Commission expressly disclaims liability for any future changes of the content of this document.

Important notice: The Commission expressly disclaims liability for any future changes of the content of this document.

NMBP-04-2017: Architectured /Advanced material concepts for intelligent bulk material structures Specific Challenge: The development of smart materials has been gathering pace over the past few years to develop novel concepts for intelligent components and structures with integrated functionalities that are able to communicate and interact with their environment, store data about their condition and react accordingly to external stimuli. Research in the areas of biomimetic bio-inspired engineering and nanomaterials can provide several examples of the development of smart materials and has seen a significant expansion. Examples include materials that can alter their physical properties, (e.g. viscosity, shape, colour and more) in response to temperature, stress, electrical or magnetic fields, convert sunlight into electricity, store energy, etc. Smart materials have also been used extensively in sensor developments in aerospace and automotive applications with the aim of producing intelligent structures and components that provide information of their in-service conditions However, there are several concepts that have not yet been implemented in industrial scale. Such technologies include self-repair or self-healing materials, materials for vibration suppression, lightweight composites that can inform the user of any internal damage without the need of time consuming and expensive Non-destructive Examination (NDE), materials or structures that can undergo shape change either passively or by activation, Functionally Graded composite Materials (FGMs), energy storing components, etc. There is a need for predictive modelling of materials functionalities for those materials for which there are currently no accurate commercial or open-source codes available.
Show more

114 Read more

DISCLAIMER OF ALL LIABILITY AND RESPONSIBILITY

DISCLAIMER OF ALL LIABILITY AND RESPONSIBILITY

THIS PAPER IS PRESENTED AS AN INFORMATIONAL SOURCE ONLY. IT IS INTENDED TO ASSIST READERS AS A LEARNING AID; IT DOES NOT CONSTITUTE LEGAL, ACCOUNTING, OR OTHER PROFESSIONAL ADVICE. IT IS NOT WRITTEN (NOR IS IT INTENDED TO BE USED) FOR PURPOSES OF ASSISTING CLIENTS, NOR TO PROMOTE, MARKET, OR RECOMMEND ANY TRANSACTION OR MATTER ADDRESSED; AND, GIVEN THE PURPOSE OF THE PAPER, IT MAY OMIT DISCUSSION OF EXCEPTIONS, QUALIFICATIONS, OR OTHER RELEVANT INFORMATION THAT MAY AFFECT ITS UTILITY IN ANY LEGAL SITUATION. THIS PAPER DOES NOT CREATE AN ATTORNEY- CLIENT RELATIONSHIP BETWEEN THE AUTHOR AND ANY READER. DUE TO THE RAPIDLY CHANGING NATURE OF THE LAW, INFORMATION
Show more

6 Read more

Aspen Group disclaims any obligation to update any forward-looking statement as a result of future developments.

Aspen Group disclaims any obligation to update any forward-looking statement as a result of future developments.

Michael Mathews - CEO I mean, I kind of touched on the answer earlier but I will reiterate it again. So I believe the acceleration of growth is a result of frankly two huge new student enrollment quarters in a row compared to the year before. So that’s again shortly after we received the accreditation for our BSN program from the CCNE. So as far as I know, again we are the only university in the country that offers RNs the ability to earn their BSN debt free by simply paying $250 a month. Since we launched BSN marketing several months ago, I mentioned earlier we’ve averaged approximately 50 BSN enrollments per month ever since. And again I think I mentioned earlier I think that’s about 35% of our total enrollment that we bring in monthly today. So that’s the key reason for the growth acceleration -- the BSN accreditation and the 50 enrollments per month that we are getting with the BSN. That just layers right on top of all the enrollments that we already do with our masters of nursing and our other programs like our MBA program across Aspen University.
Show more

9 Read more

Reliance Industries Limited PVC Business Group

Reliance Industries Limited PVC Business Group

1. Delivered sale: For delivered sale from factory unloading at customer's end will be arranged by the customer. 2. For Ex-Depot sales, customer will be responsible for arranging transportation from RIL depot to its destination and shall pay freight & discharge applicable GST thereon (Including Loading & Unloading charges). E Packaging

18 Read more

Reliance Industries Limited PVC Business Group

Reliance Industries Limited PVC Business Group

1. Delivered sale: For delivered sale from factory unloading at customer's end will be arranged by the customer. 2. For Ex-Depot sales, customer will be responsible for arranging transportation from RIL depot to its destination and shall pay freight & discharge applicable GST thereon (Including Loading & Unloading charges). E Packaging

16 Read more

Reliance Industries Limited PVC Business Group

Reliance Industries Limited PVC Business Group

a) For Contracts, Pre determined Trade Discount - Quantity can be netted off from the Price as per Pricing Zone itself. For this the customer will have to enter into a Contract as per the prescribed format. b) Trade Discount - Quantity can be granted starting with first despatch itself,based on the contracts, for payment of GST.

13 Read more

Reliance Industries Limited PVC Business Group

Reliance Industries Limited PVC Business Group

A Basic Price 1. For Ex Factory/centralised supply location BKC, Mumbai and Silvassa sale the grade wise and location wise delivered prices, as applicable are enclosed as per annexure - I For Ex-Depot supplies (i.e.Basic Price) is enclosed in Annexure II for all grades from Hazira, Gandhar & Baroda plants.

13 Read more

A Study of Corporate Social Responsibility initiative taken by Reliance Industries Limited.

A Study of Corporate Social Responsibility initiative taken by Reliance Industries Limited.

CSR is not a new concept in India. Ever since their inception, corporate like the Tata Groups, and Indian Oil Corporation, to name a few, have been involved in serving the community, through donations and charity events, many other organisations have been doing their part for the society. The basic objective of CSR in these days is to maximize the company’s overall impact on the society and stakeholders. CSR policies, practices and programs are being comprehensively integrated by an increasing number of companies throughout their business operations and processes. A growing number of corporate feel that CSR is not just another form of indirect expenses but is important for protecting the goodwill and reputation, defending attacks and increasing business competitiveness. Companies have specialized CSR teams that formulate policies, strategies and goals for their CSR programs and set aside budgets to fund them. These programs are often determined by social philosophy which have clear objectives and are well defined and are aligned with the mainstream business. The programs are put into practice by the employees who are crucial to this process. CSR programs ranges from community development to development in education, environment and healthcare etc. (Garg, 2014).
Show more

7 Read more

The Bank assumes no responsibility for this translation or for direct, indirect or any other forms or damages arising from this translation.

The Bank assumes no responsibility for this translation or for direct, indirect or any other forms or damages arising from this translation.

㸳㸬Special interests between Shinsei Bank, Limited (hereinafter, “the Bank”) and a candidate: ձ Mr. Katsuya Kawashima is a representative director or a director of SBI SECURITIES Co., Ltd., SBI Investment Co., Ltd., SBI-HIKARI P.E. Co., Ltd., SBI Regional Revitalization Advisory Co., Ltd., SBI Regional BusinessInvestment Co., Ltd., SBI regional activation support Co., Ltd., SBI Regional Revitalization Investment And Lending Co., Ltd. and SBI University Startup Incubator Co., Ltd. which have engaged in businesses that compete with the Bank. In addition, SBI Holdings, Inc., which he represents, has loan and deposit transactions with the Bank, and the Bank has invested in )LQ7HFK  Business Innovation Investment Limited Partnership, SBI AI &Blockchain Investment Limited Partnership and SBI 4㸤5 Investment Limited Partnership established by SBIInvestment, Inc. and holds shares of Money Tap Co., Ltd. As he is scheduled to retire from all of his positions at these companies by the date of this Extraordinary General Meeting of Shareholders, we believe that no specialinterest relationship will arise between him and the Bank.
Show more

14 Read more

Show all 10000 documents...