Top PDF Relationship between bladder cancer and total fluid intake: a meta analysis of epidemiological evidence

Relationship between bladder cancer and total fluid intake: a meta analysis of epidemiological evidence

Relationship between bladder cancer and total fluid intake: a meta analysis of epidemiological evidence

beneficial to the smokers who had been exposed to a high load of bladder carcinogens, such as urinary caffeine, was inversely related to urinary cotinine [51]. The Nurses’ Health Study found that a 38% reduction in bladder cancer risk was associated with increased total fluid intake among heavy smokers [34]. In our results, we also found greater consumption of fluid reduced the bladder cancer incidence among smokers. Furthermore, we also noted that the associations of fluid intake with bladder cancer risk were negative in all studies published after 2000, whereas this was not true in studies published before 2000. This phenomenon may be related to the improve- ment of the adjustment for smoking in the past decades. Interestingly, some research found that smoking status may influence the fluid choice [19]. Specifically, smokers tended to have high ingest of total fluid, coffee, and alcoholic beverages. In contrast, smokers were less likely to have a high consumption of tea.
Show more

11 Read more

Dietary fat intake and ovarian cancer risk: a meta-analysis of epidemiological studies

Dietary fat intake and ovarian cancer risk: a meta-analysis of epidemiological studies

Several limitations of this meta-analysis should be considered. First, there was substantial heterogeneity across studies assessing the associations of dietary fat intake with ovarian cancer risk. Considering the varieties of the characteristics of included populations, and study designs and types, the existence of substantial heterogeneity was reasonable, and we conducted subgroup analysis to reduce its effect on the results. Second, misclassification bias, which stemmed mainly from the misclassification of dietary assessments and pathological subtypes of ovarian cancer, should be paid enough attention to. Misclassification of dietary assessments may result from the differences across nutrient databases or designed questionnaires. Diagnosis, pathology review, and classification methods could cause misclassification bias of pathological subtypes of ovarian cancer. Third, we couldn’t rule out the effects of confounding factors and various statistical biases on our results. Furthermore, controls and confounding factor adjustment methods across individual studies were not consistent. With more and more basic and clinical researches in recent years, and the increasing understanding of the relationship between diet and health, the confounding factors controlled have markedly increased in number, and bias was inevitable. Forth, although no publication bias was found, its possible effect cannot be totally excluded.
Show more

17 Read more

Dietary fatty acids intake and endometrial cancer risk: a dose-response meta-analysis of epidemiological studies

Dietary fatty acids intake and endometrial cancer risk: a dose-response meta-analysis of epidemiological studies

heterogeneity = 0.06) for the highest compared with the lowest intakes of dietary saturated FA [21]. However, the results were hard to interpret because the definitions of the categories differed among each study [21]. During the recent five years, the findings from one of the largest population-based cohort studies, the European Prospective Investigation into Cancer and Nutrition (EPIC) found non-significant result of saturated and polyunsaturated FA but suggested significant result of monounsaturated FA intake with EC risk [9]. In contrast, the Nurses' Health Studies (NHS/NHSII) updated their evidence but found non-significant association between monounsaturated FA intake and EC risk [9]. Additionally, to our knowledge, a comprehensive and quantitative assessment of the relationship between dietary FA intake and EC risk has not been reported. Therefore, we carried out this dose-response meta-analysis of epidemiological studies to assess the aforementioned associations.
Show more

17 Read more

Vitamin A and risk of bladder cancer: a meta analysis of epidemiological studies

Vitamin A and risk of bladder cancer: a meta analysis of epidemiological studies

and retinol intake. This may be due to the inherent meth- odological differences, such as study design and different ranges of exposure among studies. Although most studies adjusted for known risk factors for bladder cancer (age, sex, and smoking), residual or unknown confounding cannot be excluded as a potential explanation for the observed heterogeneity. Also, some studies measured vitamin A intake from diet only, whereas other studies combined dietary and supplemental vitamin A intake. We used a random-effects model to try to mitigate the heterogeneity as an issue, and our sensitivity analyses did not change the results for total vitamin A and retinol intake. We further performed stratified analyses by study design, sex, geographical region, and source of intake. Nevertheless, results were similar for total vitamin A and retinol intake throughout the subgroups.
Show more

9 Read more

No association between fiber intake and prostate cancer risk: a meta analysis of epidemiological studies

No association between fiber intake and prostate cancer risk: a meta analysis of epidemiological studies

case-control studies because they are less prone to dif- ferential recall of dietary habits or selection bias. There- fore, the evidence from case-control studies should be viewed with caution, particularly considering that the combined risk estimates from all studies suggested no association. In the subgroup analysis separated by study quality, we observed that fiber intake was associated with decreased risk of prostate cancer in low-quality studies, but no significant association in high-quality studies. This may account partly for the discrepancy be- tween cohort and case-control studies, since all 5 cohort studies were high-quality studies published after 2009, while 8 of 12 case-control studies were low-quality ones. Moreover, the non-significant relationships were similar independent of study design, geographical region, method of dietary assessment, and adjustment for several essential confounders or not, further strengthening the stability of our findings.
Show more

11 Read more

Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

Association between MDM2 SNP309 T>G polymorphism and the risk of bladder cancer: new data in a Chinese population and an updated meta-analysis

the polymorphic site was amplified by PCR. The sequences of primers of rs2279744 were as follows: forward primer: 5 ′ -AGTTCAGGGTAAAGGTCACGG-3 ′ ; reverse primer: 5 ′ -GACAAGTCAGGACTTAACTCC-3 ′ . The PCR was carried out in a total volume of 15 μ L containing 1.5 μ L 10 × PCR buffer, 1 μ L genome DNA, 1.5 μ L MgCL 2 , 0.3 μ L deoxynucleotide, 0.3 μ L Taq DNA polymerase, 0.15 μ L each primer, and 10.1 μ L H 2 O. The PCR conditions were 94 ° C for 3 minutes, followed by 35 cycles at 94 ° C for 15 seconds, 55 ° C for 15 seconds, 72 ° C for 30 seconds, with a final extension at 72 ° C for 3 minutes. Then, LDR was performed using the following probes: common probe: -P-CGGCGCGGGAGGTCCGGATGATCGCTTTTTTT TT-FAM-; discriminating probe: T:TTTTTTTTTTTTTTT GGGGCCGGGGGCTGCGGGGCCGCTT; discriminating probe: G:TTTTTTTTTTTTGGGGCCGGGGGCTGCGGG GCCGCTG. LDR was carried out in 10 μ L reaction mixture containing 3 μ L PCR product, 1 μ L 10 × Taq DNA ligase buffer, 0.125 μ L Taq DNA ligase (40 U/ μ L), 0.01 μ L of each probe (10 pmol), and 5.845 μ L H 2 O. The LDR condi- tions were 30 cycles at 94 ° C for 30 seconds and 56 ° C for 3 minutes. At last, LDR products were sequenced using ABI 3730XL genetic analyzer (Applied Biosystems, Foster City, CA, USA) and the results were analyzed with GeneMapper software (Applied Biosystems). Approximately 10% of the samples were randomly selected and retested by direct DNA sequencing and the results were 100% concordant. All the
Show more

12 Read more

Bladder preservation approach versus radical cystectomy for high grade non muscle invasive bladder cancer: a meta analysis of cohort studies

Bladder preservation approach versus radical cystectomy for high grade non muscle invasive bladder cancer: a meta analysis of cohort studies

Several significant heterogeneities were observed which could be explained by the differences among studies such as study size, timing of radical cystectomy, bladder preservation modality, and follow-up time. Generally, a larger sample size or longer follow-up time represented a more stable outcome. Among the included studies, heterogeneity could be a result of radical cystec- tomy performed within or more than 3 months after diagnosis and bladder preservation modality, which var- ied from study to study. Characteristics of tumor (unifo- cal or multifocal, size, and grade) and patients (race, age, gender, and risk classification) could also contribute to the heterogeneity results. Multifocal, larger size, and higher grade result in a greater likelihood of a malignant behavior. Differences in race, age, gender, and risk classifi- cation may also cause a difference in disease feature and therapeutic responsiveness. Older patients and high-risk tumors usually have the worse prognosis. In addition, the difference in skill level of physician and pathologist will strongly affect the diagnosis and treatment and needs to be considered as an influencing factor.
Show more

15 Read more

Analysis of the relationship between exchange rate and stock prices: evidence from nigeria

Analysis of the relationship between exchange rate and stock prices: evidence from nigeria

There is theoretical consensus neither on the existence of relationship between stock prices and exchange rates nor on the direction of the relationship. Considering flow oriented models (FOM) and stock oriented models (SOM) as two basic approaches to the exchange rate determination, a cardinal disagreement can be found. Flow Oriented Models assume that the exchange rate is determined largely by a country’s current account or trade balance performance. These models posit that changes in exchange rates affect international competitiveness and trade balance, thereby influencing real economic variables such as real income and output (Dornbusch and Fisher, 1980). Stock prices, usually defined as a present value of future cash flows of firms, should adjust to the economic perspectives. Thus, flow oriented models represent a negative relationship between stock prices and exchanges rates with direction of causation running from exchange rates to stock prices. Causation can be explained as follows: domestic currency depreciation makes the local firms more competitive, making their exports cheaper in international market. Higher exports lead to higher incomes and increase in firms’ stock prices. On the other hand, stock oriented models put much stress on the role of capital account in the exchange rates determination. A rise in domestic stock prices leads to the appreciation of domestic currency through direct and indirect channel. A rise in stock prices encourages investors to buy more domestic assets selling simultaneously foreign assets to obtain domestic currency indispensable for buying new domestic stocks. Described shifts in demand and supply of currencies cause domestic currency appreciation. The indirect channel grounds in the following causality chain. An increase in domestic assets prices results in growth of wealth, which leads investors to increase their demand for money, which in turn raises domestic interest rates. Higher interest rates attract foreign capital inflow and initiate an increase in foreign demand for domestic currency and its subsequent appreciation (Branson, 1983; Frankel, 1983). Thus, this postulate a positive relationship with causality running from stock prices to exchange rate.
Show more

9 Read more

A Western Dietary Pattern Increases Prostate Cancer Risk: A Systematic Review and Meta-Analysis

A Western Dietary Pattern Increases Prostate Cancer Risk: A Systematic Review and Meta-Analysis

be biased if the probability of a study being published is dependent on its results. We used the methods of Begg and Mazumdar, and Egger et al. to detect publication bias [39,40]. Both methods test for funnel plot asymmetry, the former being based on the rank correlation between the effect estimates and their sampling variances, and the latter on a linear regression of a standard normal deviate on its precision. If a potential bias was detected, we further conducted a sensitivity analysis to assess the robustness of combined effect estimates and the possible influence of the bias and to have the bias corrected. We also conducted a sensitivity analysis to investigate the influence of a single study on the overall risk estimate by omitting one study in each turn. We considered the funnel plot to be asymmetrical if the intercept of Egger’s regression line deviated from zero with a p-value of less than 0.05. Subgroup analysis were conducted for the case-control and cohort studies. The ProMeta Version 2.0 statistical program (Internovi) and packages dosresmeta 1.3.2. for R 3.1.2. was used for the analysis [41]. All reported p values are from two-sided statistical tests, and differences with p ≤ 0.05 were considered significant.
Show more

17 Read more

LncRNA as a diagnostic and prognostic biomarker in bladder cancer: a systematic review and meta-analysis

LncRNA as a diagnostic and prognostic biomarker in bladder cancer: a systematic review and meta-analysis

Several limitations to this study should be considered. Firstly, the number of studies included in the meta-analysis was less than desirable. Data on individual lncRNAs appeared only once among the incorporated studies and few lncRNAs appeared in more than two different studies; a fact which would influence the sample heterogeneity. Secondly, different sample types (tissue, serum, and urine) and different follow-up times used in the studies induced heterogeneity. Certainly, the cut-off value and method of determining low or high levels of lncRNAs varied between different studies; and although RT-qPCR was used as the standard method to evaluate the expression of lncRNAs, this also might have caused heterogeneity of the results. To improve comparability among studies, researchers should develop a cut-off value with enhanced consistency and establish a standard method to classify high or low lncRNA expression. Thirdly, we extracted HR and 95% CI values from Kaplan–Meier curve according to Tierney’s method- ology, due to lack of survival data, which may have caused potential heterogeneity. 49 Fourthly, because most of the
Show more

10 Read more

The association between XPC Lys939Gln gene polymorphism and urinary bladder cancer susceptibility: a systematic review and meta-analysis

The association between XPC Lys939Gln gene polymorphism and urinary bladder cancer susceptibility: a systematic review and meta-analysis

This meta-analysis, including 4,828 cancer cases and 4,890 controls from 12 published case–control studies, explored the association between the XPC Lys939Gln polymorphism and bladder cancer risk. Overall, we found that there was evidence that the variant genotypes of the XPC Lys939Gln were associated with a significant increased overall risk of bladder cancer. In the subgroup analysis based on ethnicities, significant associations were found between both African and Asian populations for some genetic models, suggesting that XPD Lys939Gln polymorphism play similar roles in populations with dif- ferent genetic backgrounds and living environment. Sim- ultaneously, our results also showed that significantly increased bladder cancer risk in homozygous, heterozy- gous, recessive and allele comparison models were noted in the population-based studies but not in hospital-based studies.
Show more

7 Read more

High prevalence of secondary bladder cancer in men on radiotherapy for prostate cancer: evidence from a meta-analysis

High prevalence of secondary bladder cancer in men on radiotherapy for prostate cancer: evidence from a meta-analysis

the current study, the combined HR from the four included studies provided the 5-year lag period and demonstrated that patients who underwent RT for prostate cancer had an elevated prevalence of secondary BLCa than those who received RP therapy or non-RT intervention. These findings suggested that the secondary BLCa might be induced by radiation. Interestingly, however, it was inconsistent with the above outcomes when restricted to a 10-year lag period. The four studies reporting the 10-year lag period showed no asso- ciation between RT and secondary BLCa (HR = 1.93, 95%CI: 0.9–4.16, P= 0.093). Notably, two of four studies ascertained the relationship between RT and secondary BLCa, while the other two studies failed to find a positive association, thus a significant heterogeneity (I 2 = 93.8%, P< 0.001) was found
Show more

12 Read more

Thyroid cancer susceptibility polymorphisms: confirmation of loci on chromosomes 9q22 and 14q13, validation of a recessive 8q24 locus and failure to replicate a locus on 5q24

Thyroid cancer susceptibility polymorphisms: confirmation of loci on chromosomes 9q22 and 14q13, validation of a recessive 8q24 locus and failure to replicate a locus on 5q24

The first association between TC and common genetic vari- ants was found at the pre-miR-146a locus (4), a micro-RNA that is upregulated in thyroid tumours. 18 There was no good evidence in our study of an association between rs2910164 and TC risk under all models tested, including the heterozygous model that showed the disease association in the study of Jazdewski et al. 4 It is notable that deviations from Hardy-Weinberg equilibrium were present in the case genotypes of Jazdewski et al; it is not clear whether this was the result or the cause of the heterozy- gote association with TC risk. Other possible explanations for the differences between Jazdewski et al’s study and our own include chance, systematic differences between cases and controls (whether related to ascertainment or technical issues) and population specific effects in either study.
Show more

6 Read more

Original Article Calcium intake and the risk of stroke

Original Article Calcium intake and the risk of stroke

sumption of dairy products protects against ischemic strokes. In a prospective cohort study, Larsson et al. [40] showed that increased low- fat dairy consumption is associated with a reduced risk of total stroke (RR, 0.88; 95% CI, 0.80-0.97) and ischemic stroke (RR, 0.87; 95% CI, 0.78-0.98), but not hemorrhagic stroke (RR, 0.96; 95% CI, 0.74-1.25). Elwood et al., in a pooled-analysis of ten cohort studies, demon- strated that the highest quintile of milk con- sumption is related to a 16% reduction in isch- emic stroke risk when compared with the lowest quintile (odds ratio, 0.84; 95% CI, 0.78- 0.90). Larsson et al. [41] conducted a dose- response meta-analysis to assess the relation- ship between calcium intake and stroke risk. They determined that calcium intake was inversely associated with risk of stroke in popu- lations with a low to moderate average calcium intake. These results are consistent with our findings.
Show more

9 Read more

Markers for Diagnosis and Progression in Bladder Cancer

Markers for Diagnosis and Progression in Bladder Cancer

The most commonly studied urine markers and ap- proved by the US Food and Drug Administration (FDA) and Health Canada (BTA, NMP-22, FISH UroVysion, uCyt+/ImmunoCyt, Microsatellite analysis) have demon- strated a high sensitivity (58% - 75%) and low specificity (73% - 86%) compared to 94% of urine cytology [13]. However, as occurs with the sensitivity of the cytology, Van Rhijn et al. [14] demonstrated in the subanalysis performed per pathological grade, that this high sensitiv- ity decrease in the detection of low stage and grade tu- mors, which are the main group at primary diagnosis and recurrence. The BTA test and NMP-22 test have a very limited role because of their high false-positive rate [15,16]. But with careful selection of patients, the speci- ficity of NMP-22 can be improved, and can be used during follow-up to delay cystoscopy control [17,18]. UroVysion can repleace cytology for high-grade tumors when experience with urinary cytology is lacking or when its result is inconclusive, but adds little to the sur- veillance of low-grade tumors and might be useful to
Show more

5 Read more

Risks on N-acetyltransferase 2 and bladder cancer: a meta-analysis

Risks on N-acetyltransferase 2 and bladder cancer: a meta-analysis

the environmental factors that can cause bladder cancer. Peo- ple who engage in rubber, dyestuff, and printing industry will be more easily affected by chemical composition. In addition, the factors of inhalation of diesel exhaust and smoke are also included. These factories bring aromatic amine that mainly include high polymer aromatic amines, such as naphthylamine, 4-aminobiphenyl, benzidine, and their N-hydroxylated deriva- tive. All of these are known or potential NAT2 substrates. 36,37

6 Read more

Diagnostic significance of microRNAs as novel biomarkers for bladder cancer: a meta analysis of ten articles

Diagnostic significance of microRNAs as novel biomarkers for bladder cancer: a meta analysis of ten articles

miRNAs are a series of short (generally around 22 nucleotide long), single-stranded, and non-protein- coding RNA gene products that are vital for the regula- tion of gene expression. They work through binding their target mRNAs to cause degradation or translational silencing [13]. Recent evidence has suggested that ab- normal miRNA profiles are related to the development, progression, and prognosis of various human cancers [14, 15]. miRNAs can present extensively in plasma, serum, and urine because they are protected from RNase degradation by some membrane-secreted vesicles and/or together with RNA-binding proteins [16]. Thus non- invasive biomarkers for the diagnosis of BC may be de- veloped from the urine-based miRNAs and circulating miRNAs [17–24]. Unfortunately, the findings are incon- clusive, which may be attributable to differences in sam- ple size, ethnicity, miRNA profiling, and sample type. Therefore, a comprehensive analysis was administrated in this meta-analysis to further elucidate the diagnostic value of miRNAs in BC detection.
Show more

10 Read more

EFFECTS OF VANADIUM COMPOUNDS ON GLYCEMIC CONTROL IN TYPE 2 DIABETES MELLITUS: A META ANALYSIS OF COMPARATIVE STUDY ON RATS

EFFECTS OF VANADIUM COMPOUNDS ON GLYCEMIC CONTROL IN TYPE 2 DIABETES MELLITUS: A META ANALYSIS OF COMPARATIVE STUDY ON RATS

This meta-analysis noted high degree of heterogeneity with the mean differences of blood glucose level, fluid and food intake, average weight and plasma insulin level across the eight included articles. The possible explanations for the inconsistencies across studies might be that, the discrepancy in dose of vanadium compounds along with studies, the variation in duration of therapy, the difference in the time of blood glucose determination, the time gap between STZ- injection and start of vanadium therapy, the dissimilarity in the sex of the rats, the disparity in the age of the rats, the difference in the rats strain, the variation in the vanadium compounds used for therapy across studies.
Show more

8 Read more

The CDH1  160C/A polymorphism is associated with breast cancer: evidence from a meta analysis

The CDH1 160C/A polymorphism is associated with breast cancer: evidence from a meta analysis

that affects transcription efficiency in vitro [24]. By transi- ent transfection experiments, A allele activity was reduced by 54 and 67 % compared to the -160C allele in cervical and in colon cancer cells, respectively [24]. Therefore, the -160A CDH1 promoter variant, associated with reduced gene expression, may be regarded as a possible low pene- trance susceptibility allele for epithelial tumors. However, studies about the relation between CDH1 -160C/A poly- morphism were various. CDH1 -160A allele carriers have a significantly elevated risk for endometrial cancer [24] but not for cervical cancer and ovarian cancer [24, 25]. Thus, we were interested in resolving the controversial question regarding the significance of CDH1 -160C/A in breast can- cer pathogenesis. On this basis, the present meta-analysis study focused on breast cancer.
Show more

7 Read more

p53 status correlates with the risk of progression in stage T1 bladder cancer: a meta analysis

p53 status correlates with the risk of progression in stage T1 bladder cancer: a meta analysis

presence of heterogeneity across the studies. The hetero- geneity possibly caused by the differences in the charac- teristics of the patients, IHC technique, cutoff values, and follow-up time. Second, to reduce the bias from dif- ferent detection methods, we only included the studies measuring p53 expression by IHC. IHC has been widely used to detect molecular markers, because the method is simple, fast, and reliable [28]. However, the differences of the clones of antibody, concentration, and cutoff value used in different studies might also cause potential bias. Especially, the cutoff used to define p53 overex- pression is probably of prime importance. In the present meta-analysis, most of the studies chose a cutoff value of 20 %; p53 overexpression was a predictor of progression in T1 NMIBC, and there is low heterogeneity among these studies (I 2
Show more

8 Read more

Show all 10000 documents...

Related subjects