Top PDF Situations that Make Students Happy and Unhappy in Schools

Situations that Make Students Happy and Unhappy in Schools

Situations that Make Students Happy and Unhappy in Schools

Abstract Many research carried out so far have demonstrated that there is a direct relationship between individuals' happiness and aspects of their behaviours. That is to say, happiness has a positive relationship with life quality, job satisfaction, aggression, self-efficacy levels of individuals, vitality, optimism, altruism (self-sacrifice for the welfare of others without benefit), authenticity and self-compassion. According to the results of the research carried out by Senturk (2011), it was observed that the level of happiness may change in terms of socio-demographic features; however it provides similar results fundamentally. In his research, Sarici (2016) established that the level of happiness in the family has a positive meaningful impact on the examination results of secondary school education. In a research conducted with university students, no meaningful difference among the happiness, optimism and altruism levels of students was observed in terms of gender variable. However, the same research demonstrated that there was a meaningful difference among the happiness, optimism and altruism levels of students in terms of faculty variable. The aim of the present research is to determine the educational situations that make student teachers happy and unhappy throughout their educational lives. In line with this aim, the following questions were studied: What are the school experiences-memories that make students happy? What are the school experiences-memories that make students unhappy? What should be increased and provided more in schools? Research Model? Case study method from qualitative research methods was used in the research. Case study enables deliberate examination of the research subject. It is a favoured method in understanding various topics of education, especially when the questions of 'what, how, why' are posed in the present research, the case is educational experiences and memories that make students happy and unhappy throughout their educational lives. Data Collection, Analysis and Interpretation; In the research, interviewing method was used in data collection. The data were analysed with content analysis techniques and were presented regarding the questions posed in interview processes. Accordingly, similar data were gathered within certain concepts. They were organized and
Show more

7 Read more

When Students Make Threats

When Students Make Threats

Sources: Adapted from Reeves, M. E., Kanan, L. M., & Plog, A. E. (2010). Comprehensive planning for safe learning environments: A school professional’s guide to integrating physical and psychological safety. New York, NY: Routledge; Fein, R., Vossekuil, F., Pollack, W., Borum, R., Modzeleski, W., & Reddy, M. (2004). Threat assessment in schools: A guide to managing threatening situations and to creating safe school climates (Rev. ed.). Washington, DC: U.S. Secret Service & U.S. Department of Education; Vossekuil, B., Fein, R. A., Reddy, M., Borum, R., & Modzeleski, W. (2002). The final report and findings of the safe school initiative: Implications for the prevention of school attacks in the United States. Washington, DC: U.S. Secret Service & U.S. Department of Education.
Show more

5 Read more

IMPROVING STUDENT’S MATHEMATICAL COMMUNICATION SKILLS THROUGH MATHEMATICS  WORKSHEET BASED ON REALISTIC MATHEMATICS EDUCATION

IMPROVING STUDENT’S MATHEMATICAL COMMUNICATION SKILLS THROUGH MATHEMATICS WORKSHEET BASED ON REALISTIC MATHEMATICS EDUCATION

the worksheet is seen from the students' mathematical communication skills. From the test it was found that the average mathematical communication skills of the experimental class was higher than the control class. Learning begins with the contextual problems in accordance with the reality or environment faced by students so as to enable students to use their previous experience and initial knowledge directly. As a result, the students were happy and enthusiastic in reading and understanding the commands from the worksheet [18]. Situations and mathematical models that are self-built by students (self developed models), which is a bridge for students to make their own models from informal to formal situations. Students make their own models (horizontal mathematical) in solving contextual problems which are the linkages between models of real situations that are relevant to the environment of students into mathematical models (vertical mathematical). The students are given the widest opportunity to develop a variety of informal strategies that can lead to the construction of various procedures to solve problems. Students become active in the learning process [19]. The mind of the students is very cared for or appreciated by both himself and his friends. Optimizing the learning process through interaction between students, students with teachers, and students with facilities and infrastructure. Forms of interaction such as negotiation, explanation, justification, approval, questioning, or reflection are used to achieve the form of informal mathematical knowledge that students themselves find. Students also have good reasoning and understanding ([20], [6], [21]). By this kind of worksheet, the teachers can use various strategies in learning mathematics. In the implementation, the teachers will try to make the media so that the instructions on the worksheet run well. Learning by using RME is largely determined by the media used. If the strategy and media are well designed, the RME-based worksheet will be able to improve students' mathematical communication skills.
Show more

5 Read more

Helping Students Develop Their IEPs

Helping Students Develop Their IEPs

This guide is part of NICHCY’s Technical Assistance Guide series. It has been developed to accompany A Student’s Guide to the IEP and comes with a companion audiocassette. NICHCY also disseminates other materials and can respond to individual requests for information. For further information or assistance, or to receive a NICHCY Publications Catalog, contact NICHCY, P.O. Box 1492, Washington, DC 20013. Telephone: 1-800-695-0285 (Voice/TTY) and (202) 884-8200 (Voice/TTY). You may also e-mail us (nichcy@aed.org) or visit our Web site (www.nichcy.org), where you will find all of our publications. NICHCY thanks our Project Officer, Dr. Peggy Cvach, at the Office of Special Education Programs, U.S. Department of Education, for reviewing this TA guide and for her many helpful suggestions. We would like to express our deep appreciation to Alyne Ellis, who produced the audiotape portion of this guide package, and to Marcy McGahee-Kovac, who generously shared with us her many teaching strategies for involving students in the IEP process. Thanks go as well to the individuals who shared their insights about the IEP process and student involvement and who allowed their remarks to be tape-recorded! These are: Erin Connolly, special educator; Dr. Carol Cash, assistant principal; and Suzanne Ripley, director of NICHCY, and her husband, Scott, parents of two teenagers with disabilities.
Show more

24 Read more

The Business of Enrollment Management: Focus on Transfer Students. By: Tom von Gunden, Ph.D., corporate strategy lead, Hyland Software

The Business of Enrollment Management: Focus on Transfer Students. By: Tom von Gunden, Ph.D., corporate strategy lead, Hyland Software

Because transfer students are looking for the best possible package of accepted transfer credit, retention efforts for them start before matriculation. For an institution to prove that it will meet a student’s needs, it must be utterly clear about course equivalencies. Doing so enables students to evaluate their enrollment and registration options wisely. The faster an institution is able to answer a student’s questions about which credits will transfer, the better chance it has of moving a prospective student to a matriculated student and of seeing more students through to graduation.
Show more

8 Read more

St Albans Network of Schools : an unapproved absence or an absence with reason : students reasons for missing school without explanation

St Albans Network of Schools : an unapproved absence or an absence with reason : students reasons for missing school without explanation

numeracy, managing their budgets, promoting fund raising opportunities and operating in an increasingly competitive environment.' A school's reputation for being well resourced and a worthwhile educational institution could be at risk if it is seen to place an overemphasis on welfare and the support of students with attendance problems (Walker, 1996). Parents who want an academic focus on their child's education are likely to send their child elsewhere if they perceive the school as being too welfare focused or containing too many students with problems and high needs. From a neo-conservative perspective the market is seen as a regulator of the provision of education and the reward is improved services as school compete and offer more to gain enrolments. However an inclusion in the market system assumes the principles of free choice and that we all have an equal ability to exercise that choice. The capacity to exercise free choice is not equally distributed throughout the community and as a result free choice is actually a philosophy of inequality (Graycar &
Show more

93 Read more

Evaluation of MRSA Colonization Epidemiology before and after Practical Training in Hospitals and Healthcare Settings among Health Profession Students in Hong Kong

Evaluation of MRSA Colonization Epidemiology before and after Practical Training in Hospitals and Healthcare Settings among Health Profession Students in Hong Kong

(primer (TN1: GACTATTATTGGTTGATCCACCTG and TN2: GCCTTGACGAACTAAAGCTTCG). In order to select only for Staphylococcus aureus, the nuc gene, which encodes for the thermostable nuclease of Staphylococcus aureus, is replicated as well. Therefore, the presence of MRSA is shown by the presence of both mec A and nuc genes while that of VRSA is demonstrated by the presence of both nuc and mec A genes. The bacterial suspension will be prepared by suspending a tiny amount of bacterial isolate from a pure culture into double-distilled water (ddH2O). With the addition of the working Master mix solution, the mixture will be ready for the PCR, in which the lysis of the bacterial cells, and thus the extraction of bacterial DNA, will occur during the process of denaturation. A standard curve will be constructed using a serial dilution of the positive control. A mixture with the absence of the target DNA will serve as the contamination control to make sure that the reaction mixture is not contaminated while another mixture that contains a DNA which lacks the target sequence will serve as the negative template control to ensure that the primers are not annealed to unintended sequences. An amplification control is included as well to ensure that the reaction is indeed working even if the target is not being amplified. Spa typing will be performed on each of the MRSA isolates as described. A spa type is the composition of the VNTRs in the 3 ′ end of the staphylococcal protein a gene (spa). 
Show more

7 Read more

Happy is as Happy Does

Happy is as Happy Does

I should explain first that if our happiness set-points were indeed biologically fixed, that would not really be as bad as it sounds because the vast majority of humans seem to be relatively happy most of the time. The next slide shows the results when we asked some 2,300 of our Registry twins to indicate how they thought they compared with people in general on

8 Read more

The Contribution of Catholic Schools to the Victorian Economy and Community

The Contribution of Catholic Schools to the Victorian Economy and Community

Since it is motivated by the Christian ideal, the Catholic school is particularly sensitive to the call from every part of the world for a more just society, and it tries to make its own contribution towards it. It does not stop at the courageous teaching of the demands of justice even in the face of local opposition, but tries to put these demands into practice in its own community in the daily life of the school. In some countries, because of local laws and economic conditions, the Catholic school runs the risk of giving counter-witness by admitting a majority of children from wealthier families. Schools may have done this because of their need to be financially self-supporting. This situation is of great concern to those responsible for Catholic education, because first and foremost the Church offers its educational service to " the poor or those who are deprived of family help and affection or those who are far from the faith " 8 . Since education is an important means of improving the social and economic condition of the individual and of peoples, if the Catholic school were to turn its attention exclusively or predominantly to those from the wealthier social classes, it could be contributing towards maintaining their privileged position, and could thereby continue to favour a society which is unjust. (Sacred Congregation for Catholic Education 1977)
Show more

72 Read more

Model of Student Character Based on Character Building in Teaching Learning Process

Model of Student Character Based on Character Building in Teaching Learning Process

[3] found that character building did not receive a high priority in the teacher education curriculum. Their study stated that character building was part of the mission in most private institutions but not in public institutions. However, [6] reported that character building was provided in the curricula and was an element of the school mission statements realized in school culture in a Catholic school, a Quaker school and a public school. [7] stated that hidden curricula through social and cultural activities enhanced the character education process, especially for the quality of interpersonal communication between students, including respect, equality, helpfulness, trust, and honesty.
Show more

9 Read more

Welcome to 7th Grade Science Orientation

Welcome to 7th Grade Science Orientation

happy, then he will feel motivated to work his hardest to keep all his students happy and enjoying their science education... How do I keep Mr..[r]

48 Read more

Can brands make us happy? A research framework for the study of brands and their effects on happiness

Can brands make us happy? A research framework for the study of brands and their effects on happiness

Are we then facing a crisis in western society while we wait for an enlightened new generation to brandish the torch of citizenship as adults? Of course this depends on what is meant by citizenship and civicness. Professor Bernard Crick, who was asked to advise the British Government on introducing classes in citizenship into schools, makes a distinction between being a good citizen -obeying laws-and being an active citizen-getting involved in prescribed types of activity that are deemed of civic worth (for example voluntary work). However, this offers a somewhat narrow view of what it means to be a modern citizen living in the west, particularly if we accept that being civic and having a sense of community are perceived experiences, (Couldry et al 2007). Hence, it becomes necessary to look beyond the obvious places to better understand the state of ‘civicness’ in contemporary western society. At the same time it is also necessary to understand consumerism and its implications for civic society. In this paper we seek to do this by exploring the blurring of what has been viewed by traditionalists as two contrasting concepts, namely that of consumerism and citizen- ship, which is culminating in an emerging area of politicised consumption based on citizenly rights, obligations and social inclusion, together with competition and autonomous choice. We illustrate this emergence with specific reference to ‘green’ citizen- consumers to demonstrate the changing face of civic society in the west, where shopping can act as a vector for civic values. We begin our exploration by considering the underlying premises of civic culture, citizenship and consumerism.
Show more

12 Read more

Course Syllabus. Automotive Technology Training Center. Houston Community College System NE

Course Syllabus. Automotive Technology Training Center. Houston Community College System NE

STUDENT I.D. BADGES: Students must wear their I.D. badges 100% of the time while on campus. Students who do not have their I.D. badges will not be allowed to check out tools, or use LRC. Without all the proper tools, students cannot work in the shop and will receive a grade of “F” for shop grade for the day, or -4 point off from the daily participation grade.

8 Read more

London Challenge: survey of pupils and teachers 2006

London Challenge: survey of pupils and teachers 2006

In order to compare questions of different types, the response to each question was scored on a scale from 0 to 100. For a yes/no question, such as ‘Do you want to go on to a college or university?’, ‘No’ was scored as 0 and ‘Yes’ as 100. For questions with five options, the least positive was scored as 0 and the most positive as 100, with the intermediate options as 25, 50 and 75. The average score for each school was then calculated: this is termed the percentage positivity in this section. The variation between schools was calculated using the standard deviation of the percentage positivity scores across all schools. 11 The percentage positivity scores and their standard deviations provide a way of comparing questions and identifying those where there is the greatest variability between schools.
Show more

211 Read more

Can People Feel Happy and Sad at the Same Time?

Can People Feel Happy and Sad at the Same Time?

Both explanations, however, have difficulty with the finding that although people in emotionally complex situations were more likely to report feeling both happy and sad than were people[r]

13 Read more

Exploring Pattern of Smartphone Addiction among Students in Secondary Schools in Lagos State and its Counselling

Exploring Pattern of Smartphone Addiction among Students in Secondary Schools in Lagos State and its Counselling

Playing Game—MMORPG games for short, who make up 9.1% of gamers, and may overlap with other types of internet addiction or computer addiction. These games hold many attractions for gamers—they are interactive, social, competitive, and happen in real-time (Hartney, 2019). According to several researches on smartphone addiction, people who are addicted to smartphone shows that they have, poorer mental health and cognitive functioning including poorer impulse control and ADHD symptoms, when compared to people who are not Such addict also have increased emotional difficulties, increased depression, anxiety,social isolation, and are others.
Show more

6 Read more

Why Does The Use of Social Network Site (SNS) Make Happy? :                          A Qualitative Analysis

Why Does The Use of Social Network Site (SNS) Make Happy? : A Qualitative Analysis

Happiness is associated with the three life spaces which are social interactions, health and work (Lyubomirsky, King, & Diener, 2005). SNSs facilitate social interactions. If creating social interactions make people happy, SNSs that facilitate such interactions make people happy as well. It has been the conclusions of much research that SNSs make their users happy. Therefore, the reasons lay behind such happiness have gained more attention. Bulut and Do gan (2016) refers that SNS users use SNS with the purposes of work, socialization, joy, communication and mostly of acquisition of information. Rae and Lonborg (2015) concluded that the participants that have lots of friends on Facebook have higher levels of psychological wellbeing. Chou and Edge (2012) stated in their research with 425 undergraduates that students are happier and see life as being fairer when they use Facebook. Do gan (2016) concluded in the study “Effects of social network use on happiness, psychological well-being, and life satisfaction of high school students: case of Facebook and Twitter” that SNS usage of high school students predicted their happiness significantly and positively. Spraggins (2009) found a relationship between SNS usage and happiness and satisfaction with life. Evasiuk (2016) based his research's focus on relational happiness and jealousy due to the use of Facebook usage. It was found in the questionnaire performed with 124 participants that the participants experience happiness and jealousy due to Facebook usage. Kim and Lee (2011) showed that positive number of Facebook friends and positive personal presentation may increase users' subjective well-being level, but this share of happiness is not based on perceived social support. On the other hand, they concluded that honest self-introduction may develop social support-based happiness. Happiness is associated with three key area of life which are social relationships, health, and job (Lyubomirsky, King & Diener, 2005). SNSs facilitate social relationships. If establishing social relationships makes individuals happy, it can be concluded that SNSs which facilitate establishing these relationships cause happiness, too.
Show more

16 Read more

Welcome to 6th Grade Science Orientation 2018-19

Welcome to 6th Grade Science Orientation 2018-19

happy, then he will feel motivated to work his hardest to keep all his students happy and enjoying their science education... How do I keep Mr.[r]

43 Read more

Welcome to 7th Grade Science! 2016-17

Welcome to 7th Grade Science! 2016-17

happy, then he will feel motivated to work his hardest to keep all his students happy and enjoying their science education... How do I keep Mr..[r]

42 Read more

Towards Invigorating Talents for Careers in Media Industry: An Insight for Kenyan Schools

Towards Invigorating Talents for Careers in Media Industry: An Insight for Kenyan Schools

instruction focused within each student’s ZPD (Zone of Proximal Development) is not too difficult or too easy, but is only challenging the learner to develop new skills by building on the one already been established. Students are more receptive to learning within their ZPD for it represents the next logical step in their progress in skill development. It is believed that without reliable information on learners’ progress by evolving ZPDs, it is not easy to identify the learner who is ready for more challenging tasks and who needs additional support and assistance to constantly evolve. This can be achieved through constant mentorship and guidance. However, the status of career guidance and mentorship in creative arts careers in Kenya is an area where information is inadequate. Sindabi and Wanyama (1996), note that there is still a vacuum in the status of career guidance in Kenyan schools. Hence, there is general lack of information on dramatic arts for students to develop interest or make informed choice to pursue theatre arts in tertiary institutions for lifelong engagement.
Show more

9 Read more

Show all 10000 documents...

Related subjects