[PDF] Top 20 The Role of MCP-1(Monocyte Chemoattractant Protein-1) in Restenosis
Has 10000 "The Role of MCP-1(Monocyte Chemoattractant Protein-1) in Restenosis" found on our website. Below are the top 20 most common "The Role of MCP-1(Monocyte Chemoattractant Protein-1) in Restenosis".
The Role of MCP-1(Monocyte Chemoattractant Protein-1) in Restenosis
... Go/Gi protein, prevents the activation of mcp-1 affected by erk, with no impact on the sapk1/jnk and sapk2/p38 ...Go/Gi protein and nonreceptor tyrosin kinase in the early MCP-1 ... See full document
10
ROLE OF MONOCYTE CHEMOATTRACTANT PROTEIN-1 DURING LIVER REGENERATION
... Termination of liver regeneration is precisely regulated, yet the mechanisms that halt hepatocyte proliferation are poorly understood. Previous research implicated TGF- β due to its well known antiproliferative activity, ... See full document
52
The impact of concomitant pulmonary infection on immune dysregulation in Pneumocystis jirovecii pneumonia
... IL-17, monocyte chemoattractant protein-1 (MCP-1) and anti-inflammatory cytokines including IL-10 and transforming growth factor (TGF)- β 1 and IL-1 receptor ... See full document
11
Monocyte chemoattractant protein 1 in human atheromatous plaques
... unknown. Monocyte chemoattractant protein-1 (MCP-1) is a recently described molecule with powerful monocyte chemotactic activity expressed by monocytes, vascular ... See full document
8
Platelet-derived growth factor (PDGF)-BB-mediated induction of monocyte chemoattractant protein 1 in human astrocytes: implications for HIV-associated neuroinflammation
... human MCP-1 (GenBank accession number NM 002982) were as fol- lows: sense: CAGCAGGTGTCCCAAAGAAGCTGT antisense: ...PDGF-B, MCP-1 and 18S were purchased from SA Biosciences (Frederick, MD, ... See full document
14
Interleukin-6, MCP-1, IP-10, and MIG are sequentially expressed in cerebrospinal fluid after subarachnoid hemorrhage
... IL-6, monocyte chemoattractant protein-1 (MCP-1), interferon- γ -inducible protein-10 (IP-10), and monokine induced by interferon- γ (MIG) in the CSF of ten patients with ... See full document
6
Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes
... (IL-8, MCP- 1/CCL2) and adhesion molecules (ICAM-1) in the brain and in cultured astrocytes and brain endothelial cells [5- ...critical role not only in the initiation and propagation of ... See full document
15
Non-immunogenic dextran-coated superparamagnetic iron oxide nanoparticles: a biocompatible, size-tunable contrast agent for magnetic resonance imaging
... by 1 h chemotaxis to MCP-1 using a modified Boyden chamber ...cells; McP-1, monocyte chemoattractant protein-1; Nc, negative control; Pha, ... See full document
16
Association of Monocyte Chemoattractant Protein 1 (MCP 1) 2518A/G Polymorphism with Proliferative Diabetic Retinopathy in Korean Type 2 Diabetes
... Purpose: Monocyte chemoattractant protein-1 (MCP-1) is a chemokine that can increase adhesion molecule expression on monocytes and produce superoxide an- ...induces ... See full document
5
Enhanced monocyte chemoattractant protein 1 production in aging mice exaggerates cardiac depression during endotoxemia
... [42]. MCP-1 is a member of the C-C chemokine family, and a potent chemotactic factor for monocytes ...[43]. MCP-1 is produced by many cell types and regulates the migra- tion and infiltration ... See full document
10
Changes in Monocyte Chemoattractive Protein, Nuclear Respiratory Factor 2, B-Cell Leukemia/Lymphoma 2 and Cholinesterase in Serum of Autistic Children
... cytokine monocyte chemoattractant protein-1 (MCP-1), the transcription factor nuclear respiratory factor 2 (NRF-2), the antiapoptotic factor -cell leukemia/lymphoma 2 (Bcl2) as ... See full document
8
The detection and localization of monocyte chemoattractant protein 1 (MCP 1) in human ovarian cancer
... chemokine monocyte chemoattractant protein-1 (MCP-1) in 16/17 serous carcinomas, 4/4 mucinous carcinomas, 2/2 endometrioid carcinomas, and 1/3 borderline ...immunoreactive ... See full document
7
Effect of Andrographolide on Monocyte Chemoattractant Protein-1 Expression at the Initiation Stage of Atherosclerosis in Atherogenic Diet-Fed Rats
... on monocyte chemoattractant protein-1 (MCP-1) expression at the initiation stage of atherosclerosis in rats induced by an atherogenic ...Group 1 was given a standard ...of ... See full document
7
Monocyte chemoattractant protein 1 (MCP 1) expression in human articular cartilage Induction by peptide regulatory factors and differential effects of dexamethasone and retinoic acid
... 0.7-kb monocyte chemoattractant protein-1 (MCP-1) ...revealed MCP-1 transcripts in chondrocytes in the superficial tangential zone within 2 h of stimulation with ... See full document
10
Enhanced production of monocyte chemoattractant protein 1 in rheumatoid arthritis
... cytokine monocyte chemoattractant protein-1 (MCP-1) using sera, synovial fluid, synovial tissue, as well as macrophages and fibroblasts isolated from synovial tissues from 80 ... See full document
9
Differential regulation of the JE gene encoding the monocyte chemoattractant protein (MCP-1) in cervical carcinoma cells and derived hybrids.
... 2142-2150 0022-538X/94/$04.00+0 Copyright © 1994, American Society for Microbiology Differential Regulation of the JE Gene Encoding the Monocyte Chemoattractant Protein MCP-1 in Cervical[r] ... See full document
9
Oxygen radicals as second messengers for expression of the monocyte chemoattractant protein, JE/MCP 1, and the monocyte colony stimulating factor, CSF 1, in response to tumor necrosis factor alpha and immunoglobulin G Evidence for involvement of reduced nicotinamide adenine dinucleotide phosphate (NADPH) dependent oxidase
... The potential involvement of reactive oxygen species in the expression of genes involved in immune response was examined in mesangial cells. Tumor necrosis factor (TNF-alpha) and aggregated (aggr.) IgG increased mRNA ... See full document
9
Deregulation of inflammatory response in the diabetic condition is associated with increased ischemic brain injury
... including monocyte chemoattra- ctant protein-1 (MCP-1) and interleukin-6 (IL-6) are elevated in the plasma of diabetic patients ...chemokine, MCP-1 plays a role in ... See full document
9
Monocyte Chemoattractant Protien-1 (MCP-1) and Atherosclerosis in End Stage Renal Disease Patients
... and MCP-1 gene expressions were significantly higher than normal, indicating that a general state of micro-inflammation beyond doubt existed in the HD ...Furthermore, MCP-1 gene expression was ... See full document
8
Resistin in idiopathic inflammatory myopathies
... IL-8, monocyte chemoattractant protein (MCP)-1 and tumour necrosis factor (TNF)-a, angiogenic factors and extracellular matrix metalloproteinases, suggesting a broad contribu- tion to ... See full document
9
Related subjects