• No results found

Analysis of ASF/SF2 binding specificity against WT and U6 mutant

3 RESULTS

3.1.1 Analysis of ASF/SF2 binding specificity against WT and U6 mutant

The exonic sequence of BRCA1 exon 18 from position +4 to +10 has been previously suggested to be an ESE that interacts with the ASF/SF2 splicing factor (Liu, Cartegni et al. 2001). Moreover, the natural G6 to T mutation was predicted to abrogate this ESE and consequently ASF/SF2 binding. However, this evidence was based mainly on a computer-assisted program (ESEfinder) and the in vitro analysis of a limited number of mutants (Liu, Cartegni et al. 2001).

To test directly the interaction between exon 18 and ASF/SF2 and evaluate the role of this splicing factor in the splicing regulation, a classical pull down assay was performed using as a targets two synthetic RNA oligonucleotides (20 nt) corresponding to the first part of exon 18 WT and U6 (Fig. 3.1.1 A). These two RNA were covalently linked via their 3’ end to agarose beads and incubated in a HeLa nuclear extract. Proteins that remained tightly bound to RNA, after the washing steps, were separated on a SDS-PAGE gel, transferred to PVDF filters and probed for the presence of ASF/SF2 with a specific antibody (Fig. 3.1.1B). The results in figure 3.1.1 show that WT and U6 mutant RNAs bind to ASF/SF2 with a similar efficiency. This experiment was performed three times and confirmed the absence of any significant difference in the binding affinity between the two RNAs. The data obtained by this in vitro binding assay showed that despite the presence of the mutation, ASF/SF2 binds to both exon 18 WT and U6 sequences with similar efficiency (Fig. 3.1.1B, lanes 2-3).

A

1 15

Wt ugcagAUGCUGAGUUUGUGU

U6 ugcagAUGCUUAGUUUGUGU

B

NE WT U6

ASF/SF2

Figure 3.1.1: Western blot of pulldown analysis of BRCA1 exon 18 WT and U6 RNAs to determine the binding of ASF/SF2.

(A) Nucleotide sequences, WT and U6, of BRCA1 exon 18 synthetic RNAs. Exonic and intronic sequences are shown in upper and lower case, respectively, and the mutated nucleotide U in position +6 is underlined.

(B) Western blot analysis of ASF/SF2. A pulldown experiment of BRCA1 exon 18 WT and U6 RNAs was followed by western blot using an antibody against ASF/SF2.

Both RNAs were able to pulldown ASF/SF2 equally (lane 2 and 3). The nuclear extract sample (NE) corresponds to l/20th of the amount used for the pull down assay. The pulldown picture is representative of three independent experiments. This pulldown analysis contains an intrinsic limitation due to the difficult normalization of the amount of RNAs among the different samples. This limitation can affect a precise quantification of the small differences in ASF/SF2 binding between the two samples (see the text).

3.1.2 Analysis o f ASF/SF2 binding specificity against WT and U6 mutant and developing a new pulldown strategy.

The classical pulldown method used to test the binding capability of ASF/SF2 factor contains an intrinsic limitation due to the difficult normalization of the amount of RNAs among the different samples. In fact, the binding efficiency might be affected by erroneous quantification of the input RNA, to a different amount of oligonucleotides attached to the beads and/or to a higher level of degradation in one of the samples. All together these limitations can affect a precise quantification of the data, raising the possibilities that small differences in the binding efficiency among the samples cannot be detected.

In order to verify whether ASF/SF2 binds equally to the two RNAs, as observed (Fig. 3.1.IB, lanes 2-3), the original pull down methodology was improved by including an “internal control” for the amount of RNA used during the experiment.

In this case, the progress made on the pulldown technique was the possibility to normalise the amount of RNA that remains linked to the agarose beads. The two target sequences, WT and T6 BRCA1 exon 18, were linked to a UG motif already described in literature to be bound efficiently by the specific protein TDP43 (Buratti, Dork et al. 2001). This protein contains two RNA recognition motif (RRM) domains with distinct RNA/DNA binding characteristics and has a high affinity for single­

stranded UG stretches, starting from a minimum number of six UG (or TG), and increasing its affinity together with the number of repeats (Buratti and Baralle 2001).

As reported in detail in figure 3.1.2A, we transcribed in vitro a RNA that comprise:

the first part of BRCA1 exon 18 WT or U6, a (U)s spacer and a sequence composed by six UG dinucleotide repeats. The two transcribed RNAs were linked to agarose beads via 3’ end and incubated in a HeLa nuclear extract.

^ 1 15

GUGuWGUGUGUuuuuuugcagAIJGCIJGAGXJUUGIJGlJ— Wt Gt7GC7Gt7Gt7Gt7GOuuuuuugcagAUGCUUAGUUUGUGU — U6

( A S F / S F 2 )

GUGUGC/GC/Gt/Gt^uuuuGCACCUGAUGGUGAAGAAGACACUGCAGAGC — EDA

B

Uo«trfead ONA

1. In vitro transcribed RNA

I c

2. Binding to adipic acid dehydrazide beads

Incubation with protein extract

I

4. repeated cycles of centrifugation and washing

5. SDS-PAGE analysis

6. Western Blot analysis

2nd Ab HRP

IstAb

- f

V

T D P43

U G U G U G U G U G U G

2nd Ab *

- f

HRP

IstAb

A S F /S F 2

Figure 3.1.2: Modified pulldown analysis (see the chapter 3.1.2)

Proteins that remained tightly bound to RNA after the washing steps were separated on SDS-PAGE gel, transferred to PVDF filters and probed for the presence of the target protein with specific antibodies (Fig. 3.1.2B). During the pulldown assay, the UG repeats, present in each RNA, are specifically recognised by TDP43. By performing western blot against this protein, the pulldown was normalized for the RNA amount. Subsequently, the membrane was probed for ASF/SF2 (Fig. 3.1.2C).

This new strategy gave the opportunity of precisely comparing the different samples analysed to the TDP43 standard binding.

As reported in figure 3.1.3, the pull-down assay was followed by Western blot probed with ASF/SF2 and TDP34 antibodies. Relative to the signal of TDP43 the WT and U6 mutant RNAs bound to ASF/SF2 with a similar efficiency (Fig. 3.1.3B, lanes 2-3). Moreover, including an ASF/SF2 purine-rich enhancer as a positive control allowed the binding capability of the BRCA1 sequences to be estimated. In this case, the UG motif was linked to a previously described enhancer sequence located in the alternatively spliced fibronectin EDA exon (Lavigueur, La Branche et al. 1993; Caputi, Casari et al. 1994). This positive control clearly indicated a lower binding capability of ASF/SF2 for both exon 18 WT and U6 sequences (Fig. 3.1.3B, lane 1 vs. lanes 2-3). These results are in accordance with the data obtained with the classical pull down carried out with synthetic RNAs and suggest that the U6 mutation does not disrupt an ASF/SF2 binding site. Both sequences can bind to ASF/SF2 with lower efficiency in comparison to a classical ASF/SF2 enhancer.

A

( J D P 4 3 )

(UG)6 - (u)5 - ugcagAUGCUGAGUUUGUGU - WT (UG)6 - (u)5 - ugcagAUGCUUAGUUUGUGU - U6

(UG)6 - (u)5 - GCACCUGAUGGUGAAGAAGACACUGCAGAGC - EDA

B

NE EDA WT U6

ASF/SF2

TDP43

Figure 3.1.3: Western blot of pull-down analysis anti-ASF/SF2 normalized for TDP43 binding.

(A) Schematic representation of the in vitro transcribed RNA sequences that contain (UG)6 repeats, (U)5 spacer, part of intron 17 (lower case) and the first nucleotides of exon 18 WT and U6 mutant (upper case). The substituted nucleotide is underlined.

The bottom lane shows the EDA sequence, linked to the UGs and Us repeats, used as positive control for ASF/SF2 binding. (B) Binding analysis of ASF/SF2 protein.

After in vitro transcription, RNA was pulled down and Western blot analysis was carried out using ASF/SF2 and TDP43 antibodies. TDP43, in this case, was used to normalize the assay for the amount of RNA. Both WT and U6 RNAs were able to pulldown ASF/SF2 protein although with less efficiency if compared with the EDA positive control. The nuclear extract sample (NE) corresponds to l/20th of the amount used for the pull down assay. The pulldown picture is representative of three independent experiments. As the picture shows, both WT and U6 RNA are able to pull down ASF/SF2 protein. The WT and U6 bind approximately only 10% of ASF/SF2, compared to the EDA sample and normalized for TDP43. The binding was determined by the evaluation of the relative intensity of the bands.

3.1.3 Evaluation o f WT and T6 mutant BRCA1 exon 18 splicing efficiency by