Figure 5.1: Histograms representing the binding location, in different genomic regions, obtained by FRACKING for SRSF7 and SRSF3, normalized by segment length.
A) and B) Percentage of enrichment for the density of peaks (the number of peaks was divided by the length of each RNA feature). Bars represent relative peak abundance for: cytoplasm (Cyt), nucleoplasm (Npl) and chromatin (Chr) fractions, as stated in the legend.
A
B
Proportion of peaks (%)
SRSF3_Cyt SRSF3_Npl SRSF3_Chr
0 10 20 30 40 50 60 70
3UTR 5UTR ORF Other Intron ncRNA
0 10 20 30 40 50 60 70
3UTR 5UTR ORF Other intron ncRNA
Proportion of peaks (%)
SRSF7_Cyt SRSF7_Npl SRSF7_Chr
Figure 5.2: RT-PCR for GAPDH, using mRNA from polysome fractionation.
Presence and levels of GAPDH mRNA in the polysome fractions was tested by RT-PCR of mRNA samples extracted from the last five fractions of the polysome fractionation.
Figure 5.3 Comparison between SRSF7 FRACKING data and standard-iCLIP data.
Comparison of annotated transcripts with significant SRSF7 binding in a standard-iCLIP dataset (unpublished data, Müller-McNicoll et al.), and in the FRACKING dataset. The FRACKING data was obtained by combining the targets from cytoplasm, nucleoplasm and chromatin fractions.
5 6 7 8 9 10 -RT
Polysomes
GAPDH
Figure 5.4 Analysis of concordance between SRSF3 FRACKING data and standard-iCLIP datasets.
A) Comparison of annotated transcripts with significant SRSF3 binding in two standard-iCLIP datasets one, in dark gray produced in 2015, unpublished (Müller-McNicoll et al.), and one published in 2010, light gray [24] B) Comparison of annotated transcripts with significant SRSF3 binding in a standard-iCLIP dataset, light gray (Müller-McNicoll, et al.), and in the FRACKING dataset, dark gray. The data for FRACKING in this case was obtained by combining the targets from cytoplasm, nucleoplasm and chromatin fractions. C) Comparison of annotated transcripts with significant SRSF3 binding in a standard-iCLIP dataset, light gray [24], and FRACKING data, dark gray.
Figure 5.5 SRSF7 binding to MALAT1 transcripts in different fractions after normalization for the total number of peaks detected in each fraction.
SRSF7 binding to the MALAT1 transcript was normalized by dividing the binding signal of SRSF7 along MALAT1 by the whole number of binding detected in the specific dataset from the different fractions.
Figure 5.6 Correlation of SRSF7 FRACKING data for chromatin, nucleoplasm and cytoplasm.
Significant tags were assigned to their respective transcripts and cross-correlated between each of the four A) SRSF7 chromatin replicates, B) SRSF7 nucleoplasmic replicates and C) SRSF7 cytoplasmic replicates. Pearson correlation was used for this analysis. For the values of correlation refer to Table 5.4 for chromatin, Table 5.5 for nucleoplasm and 5.6 for cytoplasm.
Figure 5.7 Correlation of SRSF3 FRACKING data for chromatin, nucleoplasm and cytoplasm.
Significant tags were assigned to their respective transcripts and cross-correlated between each of the eight, A) SRSF3 chromatin replicates, B) SRSF3 nucleoplasmic replicates and C) SRSF3 cytoplasmic replicates. The replicates with higher correlation values are shown in closer proximity to one another. Pearson correlation was used for this analysis. For the values of correlation refer to Table 5.7 for chromatin, Table 5.8 for nucleoplasm and 5.9 for cytoplasm.
Table 5.1: Top 50 protein coding transcripts bound by SRSF7, in the subcellular fractions.
Transcripts are ordered for their FRACKING signal intensity.
Chromatin Nucleoplasm Cytoplasm Gene Symbol Gene Symbol Gene Symbol
Srsf7 Srsf7 Srsf7
Prex2 Dhx57 mt-Co1
Dhx57 Prdm2 Scd2
2610528E23Rik Snrpn 2610528E23Rik
Hexb Prex2 Canx
Huwe1 Hnrnpa2b1 Snrpn
Srrm2 Hnrnph1 Slc7a5
Ccdc44 Sfpq Dhx57
Nop56 A630089N07Rik mt-Nd6
Auts2 Canx Nfe2l1
Luc7l3 Thada Akap12
Rbm39 Mapkapk2 Hsp90ab1
Samd4 Hnrnpu Nedd4
Msi2 Slc38a2 Atp1b1
Hnrnph1 Snrpb Fn1
Srgap2 Luc7l2 Vcl
Cct6a Nufip2 Slc6a6
Hnrnpa2b1 Srsf18 Enpp3
Tsga14 Eif4a2 Itgb1
Top2a Scd2 Taf15
Gphn Ddx17 mt-Nd5
Sfpq Slc1a3 Tmem47
Taf15 Ewsr1 Srrm2
Brca1 Zc3h11a Ankrd44
Adcy1 Tardbp mt-Nd4
Luc7l2 Peg3 Msi2
Cd44 Brca1 Eef2
Sltm Elovl6 Slc4a7
Kcnj3 Fus Gnb2l1
Ncl 2610528E23Rik Gphn
Lhfp Comp Prex2
Rpl4 Samd4 Slc16a1
Wwp2 Spnb2 Sltm
Magi1 Zbtb20 Gpc3
Rpl7a Srsf1 Atp13a3
Table 5.2: Top 50 protein coding transcripts bound by SRSF3, in the subcellular fractions.
Transcripts are ordered for their FRACKING signal intensity.
Chromatin Nucleoplasm Cytoplasm Gene Symbol Gene Symbol Gene Symbol
Prex2 Srsf3 mt-Co1
Thada Srrm2 mt-Nd5
Prdm2 Nufip2 mt-Nd2
Huwe1 Prdm2 Gja1
Heg1 Cdk8 2610528E23Rik
Srsf3 Huwe1 mt-Nd1
Kcnj3 Ankrd44 mt-Cytb
Ash1l Scd2 Canx
2610528E23Rik Heg1 Scd2
Adam12 Snrpn mt-Nd4
Pdzrn3 Gja1 Slc2a3
Snrpn Phc1 Srsf3
Tsga14 Qser1 Gnb2l1
Ankrd44 Tsga14 Nufip2
Strc mt-Nd1 Eef2
Magi1 Slc38a2 Slc2a1
Atg2b Fat1 Soat1
Hnrnpa2b1 2810474O19Rik Slc38a2
Zfp207 Kcnj3 Slc7a5
Taf15 Ogt Hexb
Phc1 Pkm2 Sltm
Ext1 2610528E23Rik Hist1h4d
Rbpms mt-Co1 Nedd4
Zeb2 Zfp207 Itga6
Pbx3 Gnb2l1 Ywhae
Top2a Hsn2 Hsp90b1
Shroom2 Hnrnpa2b1 mt-Nd6
Msi2 Sema6a Eef1a1
Sema6a Thada Pabpc1
Efna5 mt-Cytb Npm1
Lars2 Eef2 Tubb5
Odz3 Taf15 Snrpn
Jarid2 Hsp90ab1 Eif4g2
Agbl1 Setd5 Srrm2
Grip1 Pabpc1 Atp1b1
Mid1 Elovl6 Actb
Dnmt3b Zbtb20 Fat1
Gphn Fn1 Nptn
Auts2 Ddx17 Zbtb20
Hnrnph1 Adcy1 Msi2
Lhfp Bat2l2 Atp2a2
Mars Tcf20 Phc1
Npm1 Npm1 Comp
Ewsr1 Eif4g2 Gpc3
Rbm39 Nedd4 Slc16a1
Table 5.3: List of primers used in this study.
Num Name Sequence
1 SRSF7 Ex3 Fw CCTCGGAGATCTCGTTTTGA
2 SRSF7 Ex5 Rv GGATCGGGAATGGGATCTA
3 SRSF7 Ex4 Fw CGCCTTGCAAATCCGACAAT
4 SRSF7 Intr4 Rv GTTTGCAGGTCGACCCTCTT
5 SRSF3 Ex3 Fw TGATTACCGCAGGAGGAGTC
6 SRSF3 Ex4 Rv TGACGCTGAAAGGGCTAGTT
7 hnRNPh1 Ex3 Fw GCGAGGCTTTTGTTGAACTT 8 hnRNPh1 Ex4 Rv TCAACACCCAATCCATTTCA 9 Arglu1 Ex2 Fw GGAAAAGCAGTTGCTCGAAG 10 Arglu1 Intr3 Rv TTCTGCTCCAGCTGCTGATA
11 GAPDH F GCAGTGGCAAAGTGGAGATT
12 GAPDH R CACCCCATTTGATGTTAGTGG
Table 5.4 Pearson correlation scores of SRSF7 chromatin FRACKING replicates.
Rep 1 Chr Rep 2 Chr Rep 3 Chr Rep 4 Chr
Rep 1 Chr 1 0.86 0.34 0.48
Rep 2 Chr 0.86 1 0.49 0.45
Rep 3 Chr 0.34 0.49 1 0.56
Rep 4 Chr 0.48 0.45 0.56 1
Table 5.5 Pearson correlation scores of SRSF7 nucleoplasm FRACKING replicates.
Table 5.6 Pearson correlation scores of SRSF7 cytoplasm FRACKING replicates.
Rep 1 Cyt Rep 2 Cyt Rep 3 Cyt Rep 4 Cyt
Rep 1 Cyt 1 0.91 0.76 0.81
Rep 2 Cyt 0.91 1 0.7 0.74
Rep 3 Cyt 0.76 0.7 1 0.57
Rep 4 Cyt 0.81 0.74 0.57 1
Table 5.7 Pearson correlation scores of SRSF3 chromatin FRACKING replicates.
Rep 1
Table 5.8 Pearson correlation scores of SRSF3 nucleoplasm FRACKING replicates.
Table 5.9 Pearson correlation scores of SRSF3 cytoplasm FRACKING replicates.
Rep 1
Glossary
40S eukaryotic small ribosomal subunit 60S eukaryotic large ribosomal subunit 80S
eukaryotic ribosome ARGLU1
arginine and glutamate-rich protein 1
CBC CAP binding complex
ultraviolet crosslinking immunoprecipitation
Cyt cytoplasm
cyto-RT-PCR cytoplasmic RT-PCR ddH2O
double distilled water DECID
decay-inducing complex DNA deoxyribonucleic acid EDTA
ethylenediaminetetraacetic acid EJC exon junction complex
ESE exonic splicing enhancers
Ex exon
FRACKING
fractionation-iCLIP GAPDH
glycerinaldehyd-3phosphat-Dehydrogenase GFP green fluorescent protein
GNB2L1
guanine nucleotide-binding protein subunit beta-2-like HITS-CLIP 1
high-throughput CLIP sequencing hnRNP
heterogeneous nuclear RNP HNRNPH1
heterogeneous nuclear RNP H1 iCLIP
individual nucleotide resolution CLIP IgG
immunoglobin G
IP immunoprecipitation
ISE
intronic splicing enhancers
L long
metastasis associated lung adenocarcinoma transcript 1 miRNA
microRNA
mRNA
messanger RNA mt-ncRNA
mitochondrial non coding RNA ncRNA
non coding RNA NMD
nonsense-mediated decay NMTR
nonsense mediate translate repression NP-40
tergitol-type NP-40
NPC nuclear pore complex
positive transcription elongation factor PAR-CLIP
photoactivatable ribonucleotide enhanced CLIP PCR polymerase chain reaction
Pol II
RBP immunoprecipitation with microarray analysis
RNA ribonucleic acid
RNA-seq
RNA sequencing
RNP ribonucleo-protein particles
RRM RNA recognition motif
serine-arginine-rich splicing factor tRNA
transfer RNA U2AF
U2 auxiliary factor
UPF regulator of nonsense transcripts UTR untranslated regions
UV ultraviolet
WT wildtype
ZnF zinc finger domain
References
1. Brugiolo M, Herzel L, Neugebauer KM: Counting on co-transcriptional splicing.
F1000prime reports 2013, 5:9.
2. Anko ML, Neugebauer KM: RNA-protein interactions in vivo: global gets specific. Trends in biochemical sciences 2012, 37(7):255-262.
3. Kishore S, Luber S, Zavolan M: Deciphering the role of RNA-binding proteins in the post-transcriptional control of gene expression. Briefings in functional genomics 2010, 9(5-6):391-404.
4. Burd CG, Dreyfuss G: Conserved structures and diversity of functions of RNA-binding proteins. Science 1994, 265(5172):615-621.
5. Collins RE, Cheng X: Structural domains in RNAi. FEBS letters 2005, 579(26):5841-5849.
6. Castello A, Fischer B, Eichelbaum K, Horos R, Beckmann BM, Strein C, Davey NE, Humphreys DT, Preiss T, Steinmetz LM et al: Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 2012, 149(6):1393-1406.
7. Baltz AG, Munschauer M, Schwanhausser B, Vasile A, Murakawa Y, Schueler M, Youngs N, Penfold-Brown D, Drew K, Milek M et al: The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Molecular cell 2012, 46(5):674-690.
8. Beyer AL, Christensen ME, Walker BW, LeStourgeon WM: Identification and characterization of the packaging proteins of core 40S hnRNP particles. Cell 1977, 11(1):127-138.
9. Le Hir H, Izaurralde E, Maquat LE, Moore MJ: The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. The EMBO journal 2000, 19(24):6860-6869.
10. Bono F, Gehring NH: Assembly, disassembly and recycling: the dynamics of exon junction complexes. RNA biology 2011, 8(1):24-29.
11. Huang Y, Gattoni R, Stevenin J, Steitz JA: SR splicing factors serve as adapter proteins for TAP-dependent mRNA export. Molecular cell 2003, 11(3):837-843.
12. Huang Y, Yario TA, Steitz JA: A molecular link between SR protein dephosphorylation and mRNA export. Proceedings of the National Academy of Sciences of the United States of America 2004, 101(26):9666-9670.
13. Lai MC, Tarn WY: Hypophosphorylated ASF/SF2 binds TAP and is present in messenger ribonucleoproteins. The Journal of biological chemistry 2004, 279(30):31745-31749.
14. Sapra AK, Anko ML, Grishina I, Lorenz M, Pabis M, Poser I, Rollins J, Weiland EM, Neugebauer KM: SR protein family members display diverse activities in the formation of nascent and mature mRNPs in vivo. Molecular cell 2009, 34(2):179-190.
15. Neugebauer KM, Roth MB: Distribution of pre-mRNA splicing factors at sites of RNA polymerase II transcription. Genes & development 1997, 11(9):1148-1159.
16. Caceres JF, Screaton GR, Krainer AR: A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes & development 1998, 12(1):55-66.
17. Roth MB, Murphy C, Gall JG: A monoclonal antibody that recognizes a phosphorylated epitope stains lampbrush chromosome loops and small granules in the amphibian germinal vesicle. The Journal of cell biology 1990, 111(6 Pt 1):2217-2223.
18. Zahler AM, Lane WS, Stolk JA, Roth MB: SR proteins: a conserved family of pre-mRNA splicing factors. Genes & development 1992, 6(5):837-847.
19. Manley JL, Krainer AR: A rational nomenclature for serine/arginine-rich protein splicing factors (SR proteins). Genes & development 2010, 24(11):1073-1074.
20. Wu JY, Maniatis T: Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 1993, 75(6):1061-1070.
21. Shen H, Kan JL, Green MR: Arginine-serine-rich domains bound at splicing enhancers contact the branchpoint to promote prespliceosome assembly. Molecular cell 2004, 13(3):367-376.
22. Blencowe BJ: Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends in biochemical sciences 2000, 25(3):106-110.
23. Lou H, Neugebauer KM, Gagel RF, Berget SM: Regulation of alternative polyadenylation by U1 snRNPs and SRp20. Molecular and cellular biology 1998, 18(9):4977-4985.
24. Anko ML, Muller-McNicoll M, Brandl H, Curk T, Gorup C, Henry I, Ule J, Neugebauer KM:
The RNA-binding landscapes of two SR proteins reveal unique functions and binding to diverse RNA classes. Genome biology 2012, 13(3):R17.
25. Ji X, Zhou Y, Pandit S, Huang J, Li H, Lin CY, Xiao R, Burge CB, Fu XD: SR proteins collaborate with 7SK and promoter-associated nascent RNA to release paused polymerase. Cell 2013, 153(4):855-868.
26. Pandit S, Zhou Y, Shiue L, Coutinho-Mansfield G, Li H, Qiu J, Huang J, Yeo GW, Ares M, Jr., Fu XD: Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing. Molecular cell 2013, 50(2):223-235.
27. Sanford JR, Wang X, Mort M, Vanduyn N, Cooper DN, Mooney SD, Edenberg HJ, Liu Y:
Splicing factor SFRS1 recognizes a functionally diverse landscape of RNA transcripts.
Genome research 2009, 19(3):381-394.
28. Ellis JD, Lleres D, Denegri M, Lamond AI, Caceres JF: Spatial mapping of splicing factor complexes involved in exon and intron definition. The Journal of cell biology 2008, 181(6):921-934.
29. Long JC, Caceres JF: The SR protein family of splicing factors: master regulators of gene expression. The Biochemical journal 2009, 417(1):15-27.
30. Graveley BR, Hertel KJ, Maniatis T: The role of U2AF35 and U2AF65 in enhancer-dependent splicing. Rna 2001, 7(6):806-818.
31. Cho S, Hoang A, Sinha R, Zhong XY, Fu XD, Krainer AR, Ghosh G: Interaction between the RNA binding domains of Ser-Arg splicing factor 1 and U1-70K snRNP protein determines early spliceosome assembly. Proceedings of the National Academy of Sciences of the United States of America 2011, 108(20):8233-8238.
32. Feng Y, Chen M, Manley JL: Phosphorylation switches the general splicing repressor SRp38 to a sequence-specific activator. Nature structural & molecular biology 2008, 15(10):1040-1048.
33. Hanamura A, Caceres JF, Mayeda A, Franza BR, Jr., Krainer AR: Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. Rna 1998, 4(4):430-444.
34. Smith CW, Valcarcel J: Alternative pre-mRNA splicing: the logic of combinatorial control. Trends in biochemical sciences 2000, 25(8):381-388.
35. Han J, Ding JH, Byeon CW, Kim JH, Hertel KJ, Jeong S, Fu XD: SR proteins induce alternative exon skipping through their activities on the flanking constitutive exons.
Molecular and cellular biology 2011, 31(4):793-802.
36. Carrillo Oesterreich F, Preibisch S, Neugebauer KM: Global analysis of nascent RNA reveals transcriptional pausing in terminal exons. Molecular cell, 40(4):571-581.
37. Alexander RD, Innocente SA, Barrass JD, Beggs JD: Splicing-dependent RNA polymerase pausing in yeast. Molecular cell 2010, 40(4):582-593.
38. Bieberstein NI, Carrillo Oesterreich F, Straube K, Neugebauer KM: First exon length controls active chromatin signatures and transcription. Cell reports 2012, 2(1):62-68.
39. Das R, Yu J, Zhang Z, Gygi MP, Krainer AR, Gygi SP, Reed R: SR proteins function in coupling RNAP II transcription to pre-mRNA splicing. Molecular cell 2007, 26(6):867-881.
40. Lin S, Coutinho-Mansfield G, Wang D, Pandit S, Fu XD: The splicing factor SC35 has an active role in transcriptional elongation. Nature structural & molecular biology 2008, 15(8):819-826.
41. Loomis RJ, Naoe Y, Parker JB, Savic V, Bozovsky MR, Macfarlan T, Manley JL, Chakravarti D: Chromatin binding of SRp20 and ASF/SF2 and dissociation from mitotic chromosomes is modulated by histone H3 serine 10 phosphorylation. Molecular cell 2009, 33(4):450-461.
42. Sanford JR, Gray NK, Beckmann K, Caceres JF: A novel role for shuttling SR proteins in mRNA translation. Genes & development 2004, 18(7):755-768.
43. Kim J, Park RY, Chen JK, Kim J, Jeong S, Ohn T: Splicing factor SRSF3 represses the translation of programmed cell death 4 mRNA by associating with the 5'-UTR region.
Cell death and differentiation 2014, 21(3):481-490.
44. Lareau LF, Inada M, Green RE, Wengrod JC, Brenner SE: Unproductive splicing of SR genes associated with highly conserved and ultraconserved DNA elements. Nature 2007, 446(7138):926-929.
45. Corbo C, Orru S, Salvatore F: SRp20: an overview of its role in human diseases.
46. Lemaire R, Prasad J, Kashima T, Gustafson J, Manley JL, Lafyatis R: Stability of a PKCI-1-related mRNA is controlled by the splicing factor ASF/SF2: a novel function for SR proteins. Genes & development 2002, 16(5):594-607.
47. Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA et al: The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Molecular cell 2010, 39(6):925-938.
48. Nakagawa S, Ip JY, Shioi G, Tripathi V, Zong X, Hirose T, Prasanth KV: Malat1 is not an essential component of nuclear speckles in mice. Rna 2012, 18(8):1487-1499.
49. Tripathi V, Song DY, Zong X, Shevtsov SP, Hearn S, Fu XD, Dundr M, Prasanth KV: SRSF1 regulates the assembly of pre-mRNA processing factors in nuclear speckles. Molecular biology of the cell 2012, 23(18):3694-3706.
50. Wu H, Sun S, Tu K, Gao Y, Xie B, Krainer AR, Zhu J: A splicing-independent function of SF2/ASF in microRNA processing. Molecular cell 2010, 38(1):67-77.
51. Houseley J, Tollervey D: The many pathways of RNA degradation. Cell 2009, 136(4):763-776.
52. Cordin O, Banroques J, Tanner NK, Linder P: The DEAD-box protein family of RNA helicases. Gene 2006, 367:17-37.
53. Rajkowitsch L, Chen D, Stampfl S, Semrad K, Waldsich C, Mayer O, Jantsch MF, Konrat R, Blasi U, Schroeder R: RNA chaperones, RNA annealers and RNA helicases. RNA biology 2007, 4(3):118-130.
54. Lee HC, Oh N, Cho H, Choe J, Kim YK: Nonsense-mediated translational repression involves exon junction complex downstream of premature translation termination codon. FEBS letters 2010, 584(4):795-800.
55. Popp MW, Maquat LE: Organizing principles of mammalian nonsense-mediated mRNA decay. Annual review of genetics 2013, 47:139-165.
56. Kervestin S, Jacobson A: NMD: a multifaceted response to premature translational termination. Nature reviews Molecular cell biology 2012, 13(11):700-712.
57. Shyu AB, Wilkinson MF, van Hoof A: Messenger RNA regulation: to translate or to degrade. The EMBO journal 2008, 27(3):471-481.
58. Hwang J, Kim YK: When a ribosome encounters a premature termination codon. BMB reports 2013, 46(1):9-16.
59. Lejeune F, Li X, Maquat LE: Nonsense-mediated mRNA decay in mammalian cells involves decapping, deadenylating, and exonucleolytic activities. Molecular cell 2003, 12(3):675-687.
60. Arias-Palomo E, Yamashita A, Fernandez IS, Nunez-Ramirez R, Bamba Y, Izumi N, Ohno S, Llorca O: The nonsense-mediated mRNA decay SMG-1 kinase is regulated by large-scale conformational changes controlled by SMG-8. Genes & development 2011, 25(2):153-164.
61. Kashima I, Jonas S, Jayachandran U, Buchwald G, Conti E, Lupas AN, Izaurralde E: SMG6 interacts with the exon junction complex via two conserved EJC-binding motifs (EBMs) required for nonsense-mediated mRNA decay. Genes & development 2010, 24(21):2440-2450.
62. Fukuhara N, Ebert J, Unterholzner L, Lindner D, Izaurralde E, Conti E: SMG7 is a 14-3-3-like adaptor in the nonsense-mediated mRNA decay pathway. Molecular cell 2005, 17(4):537-547.
63. Decatur WA, Fournier MJ: RNA-guided nucleotide modification of ribosomal and other RNAs. The Journal of biological chemistry 2003, 278(2):695-698.
64. Matera AG, Terns RM, Terns MP: Non-coding RNAs: lessons from the small nuclear and small nucleolar RNAs. Nature reviews Molecular cell biology 2007, 8(3):209-220.
65. Williams GT, Farzaneh F: Are snoRNAs and snoRNA host genes new players in cancer?
Nature reviews Cancer 2012, 12(2):84-88.
66. Kiss T: Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions. Cell 2002, 109(2):145-148.
67. McKeegan KS, Debieux CM, Boulon S, Bertrand E, Watkins NJ: A dynamic scaffold of pre-snoRNP factors facilitates human box C/D pre-snoRNP assembly. Molecular and cellular biology 2007, 27(19):6782-6793.
68. Boulon S, Marmier-Gourrier N, Pradet-Balade B, Wurth L, Verheggen C, Jady BE, Rothe B, Pescia C, Robert MC, Kiss T et al: The Hsp90 chaperone controls the biogenesis of L7Ae RNPs through conserved machinery. The Journal of cell biology 2008, 180(3):579-595.
69. van Nues RW, Granneman S, Kudla G, Sloan KE, Chicken M, Tollervey D, Watkins NJ: Box C/D snoRNP catalysed methylation is aided by additional pre-rRNA base-pairing. The EMBO journal 2011, 30(12):2420-2430.
70. Brooks SA, Rigby WF: Characterization of the mRNA ligands bound by the RNA binding protein hnRNP A2 utilizing a novel in vivo technique. Nucleic acids research 2000, 28(10):E49.
71. Mili S, Steitz JA: Evidence for reassociation of RNA-binding proteins after cell lysis:
implications for the interpretation of immunoprecipitation analyses. Rna 2004, 10(11):1692-1694.
72. Ule J, Jensen KB, Ruggiu M, Mele A, Ule A, Darnell RB: CLIP identifies Nova-regulated RNA networks in the brain. Science 2003, 302(5648):1212-1215.
73. Ule J, Jensen K, Mele A, Darnell RB: CLIP: a method for identifying protein-RNA interaction sites in living cells. Methods 2005, 37(4):376-386.
74. Yeo GW, Coufal NG, Liang TY, Peng GE, Fu XD, Gage FH: An RNA code for the FOX2 splicing regulator revealed by mapping RNA-protein interactions in stem cells. Nature structural & molecular biology 2009, 16(2):130-137.
75. Hafner M, Landthaler M, Burger L, Khorshid M, Hausser J, Berninger P, Rothballer A, Ascano M, Jr., Jungkamp AC, Munschauer M et al: Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell 2010, 141(1):129-141.
76. Konig J, Zarnack K, Rot G, Curk T, Kayikci M, Zupan B, Turner DJ, Luscombe NM, Ule J:
iCLIP reveals the function of hnRNP particles in splicing at individual nucleotide resolution. Nature structural & molecular biology 2010, 17(7):909-915.
77. Huppertz I, Attig J, D'Ambrogio A, Easton LE, Sibley CR, Sugimoto Y, Tajnik M, Konig J, Ule J: iCLIP: protein-RNA interactions at nucleotide resolution. Methods 2014, 65(3):274-287.
78. Machyna M, Kehr S, Straube K, Kappei D, Buchholz F, Butter F, Ule J, Hertel J, Stadler PF, Neugebauer KM: The coilin interactome identifies hundreds of small noncoding RNAs that traffic through Cajal bodies. Molecular cell 2014, 56(3):389-399.
79. Sugimoto Y, Konig J, Hussain S, Zupan B, Curk T, Frye M, Ule J: Analysis of CLIP and iCLIP methods for nucleotide-resolution studies of protein-RNA interactions. Genome biology 2012, 13(8):R67.
80. Graham JM, Rickwood D: Subcellular fractionaton : a practical approach. Oxford: IRL Press at Oxford University Press; 1997.
81. Potter VR: The assay of animal tissues for respiratory enzymes; the malic dehydrogenas system. The Journal of biological chemistry 1946, 165(1):311-324.
82. Schneider WC: Intracellular distribution of enzymes; the oxidation of octanoic acid by rat liver fractions. The Journal of biological chemistry 1948, 176(1):259-266.
83. Herzel L, Neugebauer KM: Quantification of co-transcriptional splicing from RNA-Seq data. Methods 2015.
84. Suzuki K, Bose P, Leong-Quong RY, Fujita DJ, Riabowol K: REAP: A two minute cell fractionation method. BMC research notes 2010, 3:294.
85. Bernabeu C, Tobin EM, Fowler A, Zabin I, Lake JA: Nascent polypeptide chains exit the ribosome in the same relative position in both eucaryotes and procaryotes. The Journal of cell biology 1983, 96(5):1471-1474.
86. Blobel G, Sabatini D: Dissociation of mammalian polyribosomes into subunits by puromycin. Proceedings of the National Academy of Sciences of the United States of America 1971, 68(2):390-394.
87. Li K, Subramanian AR: Selective separation procedure for determination of ribosomal proteins L7 and L12. Analytical biochemistry 1975, 64(1):121-129.
88. Anko ML, Morales L, Henry I, Beyer A, Neugebauer KM: Global analysis reveals SRp20-
88. Anko ML, Morales L, Henry I, Beyer A, Neugebauer KM: Global analysis reveals SRp20-