• No results found

Before you Begin

In document DIG Northern Starter Kit (Page 7-12)

2. How to Use this Product

2.1. Before you Begin

Templates for labeling reaction

• Linearized plasmid, including the appropriate RNA polymerase promoter sequence (SP6, T3, T7).

The length of the region to be transcribed should be in the range of 200 to 1,000 bp. Phenolize DNA to avoid RNase contamination.

• Specially prepared PCR product, see section, Protocols, Preparing DNA template from total RNA using RT-PCR and RT-PCR.

General Considerations

Precautions

• Work under clean and RNase-free conditions.

• Use DMPC- or DEPC-treated water for preparation of all solutions.

• Autoclave solutions.

• Tween 20* should be added to previously autoclaved or sterile-filtered solutions.

• Rigorously clean and rinse incubation trays with a cleaning agent for removing RNases or bake glass trays 8 hours at +200°C before use.

• Wear powder-free gloves when handling membranes.

• Handle membrane only on the edges with clean forceps.

Standard method for DNA template preparation

Purify plasmid DNA using the High Pure Plasmid Isolation Kit*.

Linearize DNA template at a restriction site downstream of the cloned insert. The sequence to be transcribed should be 200 to 1,000 bp in length.

To avoid transcription of undesirable sequences, use a restriction enzyme that leaves a 5′ overhang or blunt ends.

After restriction digest, purify the DNA by phenol/chloroform extraction, followed by ethanol precipitation.

Dissolve template DNA in 10 mM Tris, 0.1 mM EDTA, pH 8,0.

Too much EDTA inhibits the transcription reaction; do not use >0.1 mM EDTA in the TE buffer to dissolve the DNA.

1 2

3 4 5

2. How to Use this Product

DNA template preparation from total RNA using RT-PCR and PCR

The following steps describe an alternative method for generating templates for in vitro transcription labeling of RNA with DIG without cloning.

Prepare total RNA with one of the standard methods.

Run an RT-PCR with oligo(dT) primer using the Expand Reverse Transcriptase System.

Run the PCR with specially designed primers, including the sequence of the appropriate RNA polymerase promoter.

– Use standard PCR conditions; for best results, use the Expand High Fidelity PCR System*.

RNA polymerase promoter sequences

Promoter Sequence

SP6 RNA Polymerase Do not use SP6 promoter consensus sequences for PCR-generated DNA fragments;

experiments show that SP6 Polymerase can only initiate efficient transcription if the promoter sequences lie within a plasmid environment.

T7 RNA Polymerase 5′TAATACGACTCACTATAGGG/X-mer or 5′TAATACGACTCACTATAGGA/X-mer

T3 RNA Polymerase 5′AATTAACCCTCACTAAAGGG/X-mer

Factors influencing stringency in hybridization

• The degree of homology of the probe to the target RNA is an important factor for determining the appropriate hybridization conditions.

• Stringency is influenced by temperature; high temperature increases stringency of hybridization, low temperature decreases stringency.

• For RNA:RNA hybridizations with DIG Easy Hyb, use a hybridization temperature of +68°C.

The temperature may have to be adjusted depending on the GC content and homology of probe to target.

Precautions for immunological detection

• Work under clean, RNase-free conditions for the entire detection procedure.

• If the membrane is to be reprobed, do not allow the membrane to dry at any time.

Handle membranes only with powder-free gloves.

• Use sufficient volume of all solutions.

• Make sure that membranes do not stick to trays during detection.

Do not let membranes stick together.

• Shake membranes during the whole procedure.

• When using laboratory trays for the detection procedure, they should be rigorously cleaned before use.

• Work under clean conditions when handling the chemiluminescent substrate solution and avoid phosphatase contamination.

• Perform Anti-DIG-AP binding and chemiluminescent development in separate trays.

• For chemiluminescent detection, seal membranes in plastic bags or development folders.

1 2 3

2. How to Use this Product

Safety Information

Laboratory procedures

• Handle all samples as if potentially infectious, using safe laboratory procedures. As the sensitivity and titer of potential pathogens in the sample material varies, the operator must optimize pathogen inactivation by the Lysis / Binding Buffer or take appropriate measures, according to local safety regulations.

• Do not eat, drink or smoke in the laboratory work area.

• Do not pipette by mouth.

• Wear protective disposable gloves, laboratory coats and eye protection, when handling samples and kit reagents.

• Wash hands thoroughly after handling samples and reagents.

Waste handling

• Discard unused reagents and waste in accordance with country, federal, state, and local regulations.

• Safety Data Sheets (SDS) are available online on dialog.roche.com, or upon request from the local Roche office.

Working Solution

The Washing buffer, Maleic acid buffer, Blocking solution, and Detection buffer are also available tested on the absence of DNases and RNases in the DIG Wash and Block Buffer Set*. These solutions are also used in the detection procedure and can be prepared in larger quantities.

DIG RNA labeling

Solution Composition/Preparation Storage and Stability For use in...

Water Autoclaved, DMPC- or

DEPC-treated double-distilled water Store at +15 to +25°C. Dilution of solutions.

EDTA 0.2 M

ethylenediamine-tetraacetic acid, pH 8.0 Store at +15 to +25°C. Stops the reaction.

2. How to Use this Product

Determination of labeling efficiency

Solution Composition/Preparation Storage and Stability For use in...

RNA dilution buffer Mix DMPC- or DEPC-treated, double-distilled water: 20x SSC:

37% formaldehyde in a ratio of 5:3:2.

Always prepare fresh. Dilution of RNA.

Washing buffer 0.1 M maleic acid, 0.15 M NaCl, pH 7.5 (+20°C), 0.3% (v/v) Tween 20*

Store at +15 to +25°C. Removal of nonspecific bound antibody.

Maleic acid buffer 0.1 M maleic acid, 0.15 M NaCl, adjust with solid NaOH to pH 7.5 (+20°C)

Dilution of Blocking Solution.

Detection buffer 0.1 M Tris-HCl*, 0.1 M NaCl, pH

9.5 (+20°C) Adjustment of pH to 9.5.

Preparation of kit working solutions

Blocking solution,1x Dilute the 10x Blocking Solution (Bottle 10) 1:10 in Maleic acid buffer.

Always prepare fresh. Blocking of nonspecific binding sites on the membrane.

Antibody solution • Centrifuge Anti-Digoxigenin-AP (Vial 5) for 5 minutes at 10,000 rpm in the original vial prior to each use, and pipette the necessary amount carefully from the surface.

• Dilute Anti-Digoxigenin-AP 1:10,000 (75 mU/ml) in 1x Blocking Solution.

Store at +2 to +8°C for

12 hours. Binding to the DIG-labeled

probe.

Formaldehyde gel

Solution Composition/Preparation Storage and Stability For use in...

10x MOPS, pH 7.0

(with NaOH) • 200 mM MOPS

• 50 mM sodium acetate

• 20 mM EDTA

– Preparation of stock

solution.

Loading buffer • 250 μl of 100% Formamide*

• 83 μl of 37% formaldehyde

• 50 μl 10x MOPS

• 50 μl 100% glycerol

• 10 μl 2.5% bromophenol blue

• 57 μl DEPC/DMPC-treated water

Always prepare fresh. Loading samples in the gel.

Gel with 2%

formaldehyde • 1.8 g Agarose*

• 141.9 ml 1x MOPS

• 8.1 ml 37% formaldehyde

– Separation of samples.

Running buffer 1x MOPS – Gel electrophoresis.

2. How to Use this Product

Hybridization

Solution Composition/Preparation Storage and Stability For use in...

DIG Easy Hyb Granules working buffer

Reconstitute granules (Bottle 9) by carefully adding 64 ml autoclaved, double-distilled, DEPC- or DMPC-treated water in two portions to the plastic bottle;

dissolve by stirring at +37°C.

DIG Easy Hyb Granules must be dissolved under RNase-free conditions.

Store for 1 month

at +15 to +25°C. Prehybridization and hybridization solution.

Immunological detection

Solution Composition/Preparation Storage and Stability For use in...

Washing buffer 0.1 M maleic acid, 0.15 M NaCl, pH 7.5 (+20°C), 0.3% (v/v) Tween 20*

Store at +15 to +25°C. Removal of nonspecific bound antibody.

Maleic acid buffer 0.1 M maleic acid, 0.15 M NaCl, adjust with solid NaOH to pH 7.5 (+20°C)

Dilution of Blocking Solution.

Detection buffer 0.1 M Tris-HCl*, 0.1 M NaCl, pH

9.5 (+20°C) Adjustment of pH to 9.5.

Preparation of kit working solutions

Blocking solution,1x Dilute 10x Blocking Solution (Bottle 10) 1:10 with Maleic acid buffer.

Always prepare fresh. Blocking of nonspecific binding sites on the membrane.

Antibody solution • Centrifuge Anti-Digoxigenin-AP (Vial 5) for 5 minutes at 10,000 rpm in the original vial prior to each use, and pipette the necessary amount carefully from the surface.

• Dilute Anti-Digoxigenin-AP 1:10,000 (75 mU/ml) in 1x Blocking solution.

Store at +2 to +8°C for

12 hours. Binding to the DIG-labeled

probe.

Stripping and reprobing of RNA blots

Solution Composition/Preparation Storage and Stability For use in...

Water Autoclaved DMPC- or

DEPC-treated double-distilled water Store at +15 to +25°C. Washing the membrane.

Stripping buffer • 50% Formamide* Always prepare fresh. Removing DIG-labeled

2. How to Use this Product

In document DIG Northern Starter Kit (Page 7-12)

Related documents