Candidate Effector Gene Cloning

RNA was extracted from J2 nematodes of G. pallida Pa1 and Lindley populations using the TRIzol Reagent Kit (Life Technologies). Hatched J2s (from approximately 100 cysts) were removed from the hatching petri dishes and pipetted into 50ml tubes. Each tube was centrifuged for 10 min at 2,500rpm to pellet the juveniles. Excess TRD was removed and the pelleted juveniles

95°C 20 seconds

95°C 3 seconds

transferred to a fresh 2ml microcentrifuge tube. Tubes containing juveniles were flash frozen in liquid nitrogen before the pellet was placed in a pre-cooled mortar. Juveniles were crushed with a pre-cooled pestle before 1ml TRIzol reagent was added. The juvenile/TRIzol solution was transferred to a fresh 2ml microcentrifuge tube and left to incubate for 5 min at RT. After incubation 200µl chloroform was added and the tube was vigorously shaken by hand for 15 sec, before a 3 min incubation at RT. The samples were centrifuged for 15 min (10,000rpm at 4°C) before the aqueous layer was removed and pipetted into a fresh tube to which 500µl 100% isopropanol was added, and incubated at RT for 10 min. The sample was centrifuged for 10 min (10,000rpm at 4°C), before the supernatant was removed, leaving the RNA pellet. The pellet was washed with 1ml 75% ethanol and centrifuged for 5 min (8,000rpm at 4°C), before the supernatant was discarded and the pellet left to air dry and re-suspended in 20µl RNAse-free H2O.

Extracted RNA was then DNase treated using the RQ1 RNase-Free DNase Kit (Promega). Eight microlitres of RNA was mixed with 1µl each of RQ1 10x Reaction Buffer and RQ1 RNase-Free DNase before being incubated at 37°C for 30 min. After incubation, 1µl of RQ1 DNase Stop Solution was added, and the sample incubated at 65°C for 10 min.

DNase-treated RNA was used with the SuperScript III Reverse Transcriptase (Invitrogen) to generate cDNA. The following was added to a nuclease-free microcentrifuge tube:

The sample was incubated for 5 min at 65°C and then on ice for at least 1 min. The sample was briefly centrifuged before the following were added:

Reagent Volume for 1 reaction

oligo(dT)20 (50µM) 1µl

RNA 11µl

dNTP (10mM) 1µl

Samples were incubated at 50°C for 60 min, before they were heated to 70°C for 15 min to inactivate the reaction.

5.3.5.2 Amplification of Candidate Effector Genes

Primers were designed using the full length of the effector gene (minus the signal peptide) using Primer3 (http://primer3.ut.ee/), as outlined in section 2.2.6. Primer sequences for each candidate were as follows:

The sequence in red is the artificial Kozak start (ACCATG) which was added to replace the ATG start codon which was removed with the signal peptide and stop (TGA) was included to ensure no additional sequence was added when expressed in planta which may affect function of each of the genes.

Genes were amplified from cDNA made from both Pa1 and Lindley using KOD hot start polymerase using the following reagents and conditions:

GPLIN_000008800

Forward ACCATGACGGGGAAAAGTGGAGG

Reverse TGATCAATATTCGATTCTTTGGTTTTG GPLIN_000926600

Forward ACCATGACACCTAACGATAACCCGA

Reverse TGATCAAGCACAGAAAGGCGAAA

Reagent Volume for 1 reaction 5x First-Strand Buffer 4µl

0.1M DTT 1µl

RNAseOUT 1µl

SuperScript III RT 1µl Total volume 20µl

The annealing temperature for GPLIN_000008800 was 63°C with a 1 min 45 sec extension, while GPLIN_000926600 has an annealing temperature of 58°C and an elongation time of 1 min 5 sec.

PCR products were visualised on a 1% agarose gel, and bands of the anticipated size were excised and purified using QIAquick Gel Extraction kit (QIAGEN) and eluted into 30µl of elution buffer.

5.3.5.3 Amplification of attB gene

Purified effector genes underwent a second amplification to incorporate the attB

gene which is necessary for cloning into the pDONR vector. The primers used for this were as follows:

Samples were amplified as outlined above (see 5.3.5.2), but the purified candidate effector PCR product was used as template instead of cDNA. As above, samples were visualised on a 1% agarose gel and purified.

Reagent Volume Water 32µl KOD Buffer (10X) 5µl MgSO4 (25mM) 3µl dNTPs (2mM) 5µl Forward primer (10µM) 1.5µl Reverse primer (10µM) 1.5µl KOD (1u/µl) 1µl J2 cDNA 1µl 50µl 95°C 2 minutes 95°C 20 seconds X°C 10 seconds 70°C X 70°C 3 minutes 12°C hold x40 cycles GPLIN_000008800 Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTCACCATGACGGGGAAAAG Reverse GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATCAATATTCGATTC GPLIN_000926600 Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTCACCATGACACCTAAC Reverse GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATCAAGCACAGAAAG

5.3.5.4 BP Clonase Ligation into pDONR207

Purified effector PCR product was mixed with vector and BP Clonase enzyme as follows:

The reaction was incubated at 25°C for 1h, before 1µl of Proteinase K was added and the sample incubated for 10 min at 37°C.

5.3.5.5 Transformation into JM109 Chemically Competent Cells

1µl of each BP reaction was transformed into 50µl of JM109 chemically competent cells (Invitrogen). Samples were placed on ice for 20 min before being heat-shocked for 47 sec at 42°C, 900µl of SOC was added and cells were left to recover for 90 min at 37°C before 100µl of the transformation was plated onto LB + Gentamycin (100µg/ml) plates.

Bacterial clones were PCR tested to ensure that they contained the correct insert using the PCR conditions detailed above (see 5.3.5.2), but using the following primer pair at an annealing temperature of 56°C:

5.3.5.6 LR Reaction into pGR106GW Destination Vector

Cloned pDONR207 inserts were Sanger sequenced to ensure the target sequence was incorporated. The following steps to clone into the destination vector were only undertaken when the anticipated target sequence had been successfully cloned. An LR reaction was set-up as follows and was incubated overnight at room temperature:

pDONR207-FOR CGGCGGATTTGTCCTAC pDONR207-REV AACACCCCTTGTATTACTGTTTAT Reagent Volume attB-PCR product 7µl Vector pDONR207 (150ng/µl) 1µl BP Clonase 2µl

After incubation, 1µl of Proteinase K was added and samples were incubated for 10 min at 37°C. Samples were then transformed into JM109 cells (see 5.3.5.5) and plated onto LB + Kanamycin (50µg/ml) plates. Colonies present on the plate were then screened (see 5.3.5.2) to check for the correct insert using the following primer set:

Positive samples were used to start liquid cultures (5ml LB + Kanamycin), left to incubate overnight at 37°C, then purified using GeneJET Plasmid Purification (ThermoFisher) with a final elution volume of 50µl.

5.3.5.7 Transformation of PVX vectors into electro-competent Agrobacterium

pGR106GW clones were diluted to a concentration of 10ng/µl and 2µl were transformed into GV3101 electro-competent Agrobacterium. Vector/bacteria mixtures were transferred to chilled electroporation cuvettes (Biorad) and shocked for 2 ms at 1.8kV. Cells were then re-suspended in 500µl SOC media (2% tryptone, 0.5% yeast extract, 10mM NaCl, 2.5mM KCl, 20mM glucose, 10mM MgCl2) and incubated for 2h at 28°C. Transformed cells were plated onto LB + Kanamycin (50µg/ml), Rifamycin (25µg/ml) and Chloramphenicol (30µg/ml) agar dishes and incubated at 28°C for 48h. Colonies grown on the plate were screened for the plasmid insertion. One positive clone for each construct was then re- propagated on low salt LB + mannitol plates (1% tryptone, 0.5% yeast extract, 0.25% NaCl2, 1% mannitol) with the above antibiotics and incubated at 28°C for 48h.

5.3.5.8 Agrobacterium-mediated Transient Expression Assay

Reagent Volume pENTRY clone 60ng pGR106GW (25ng/µl) 6µl LR clonase 1µl PVX-201-Seq-F GCAGTCATTAGCACTTCCTTAGTGAGG PVX-201-Seq-R CCTGAAGCTGTGGCAGGAGTTGCGC

CRN2 and GFP genes (clones received from The James Hutton Institute Nematology Lab) were used as positive and negative controls respectively, were grown overnight at 28°C. Resistant P55/7 leaves were harvested and used for this vacuum infiltration experiment. All steps were undertaken as outlined in section 2.2.8.