• No results found

Cell migration methods

AAACAAGGCUGAUAAUUUG

2.8 Cell migration methods

2.8.1 Cell migration assays

LNCaP, 22Rv1 and PC3 cells as well as cell lines transfected with siRNA were plated onto circular glass coverslips (13 mm2) pre-coated overnight with 0.01% poly-l-lysine at a cell density of 3 x 105 cells/mL in 500 µL medium per well. Cells were incubated for 24 hours. After 24 hours, the attached cells were scratched with a P20 pipette tip and replicate wells fixed at 0 hour, 4 hour and 6 hour by removing the medium and incubating in 4% paraformaldehyde for 20 minutes at room temperature with agitation. The fixed cells were washed 3 times by incubating with PBS for 10 minutes at room temperature with agitation. After the last wash, the coverslips were stored in PBS at 4 ºC until further analysis.

2.8.2 Immunostaining

To visualise cell migration, the cell nuclei were stained with 0.01% Nuclear Yellow (Invitrogen, USA) in 250 µL PBS per well in a 24-well plate for 10 minutes with agitation. This was followed by 3X 10 minutes PBS washes with agitation and then the coverslips were rinsed in MilliQ® water. Coverslips were mounted onto glass slides using Permafluor mounting medium (Immunotech, Marseilles, France). Fluorescence was viewed with an Olympus BX-50 microscope and images were acquired with a Magnafire CCD camera (Optronics, Goleta, CA). Photos were taken at 20x magnification.

49 2.9Chromatin methods

2.9.1 Chromatin accessibility assay (CHART-PCR)

Chromatin accessibility to digestion with micrococcal nuclease (MNase) was analysed using CHART-PCR as described in Rao et al., (2001). To isolate the nuclei, LNCaP, 22Rv1 and PC3 cells at 5 x 105 cells/mL were centrifuged for 5 minutes at 500g, washed with PBS and resuspended in 1 mL of ice cold nuclei buffer (10 mM Tris pH7.5, 10 mM NaCl, 3 mM MgCl2, 0.1 mM EDTA and 0.5% Igepal, 0.15 mM spermine, 0.5 mM spermidine). The cells were incubated on ice for 5 minutes and the nuclei were recovered by centrifugation at 3000 g for 3 minutes, washed with 1 mL of ice cold MNase buffer (10 mM Tris pH7.5, 15 mM NaCl, 60 mM KCl, 0.15 mM spermine, 0.5 mM spermidine), centrifuged at 3000 g for 3 minutes and resuspended in 200 µL MNase buffer. Nuclei (94 µL) were treated with 25 U MNase (Sigma-Aldrich Corporation, USA) and 1 µL 0.1 M CaCl2 for 5 minutes at room temperature, as determined empirically. For each sample, a control (without the enzyme) was incubated in a similar way to monitor the endonuclease activity. An aliquot of 20 µL stop buffer (0.1 M EDTA pH8, 0.05 M EGTA pH8) was added to quench the reaction. Genomic DNA was isolated using a QIAamp blood kit (Qiagen, USA) according to the manufacturer’s instructions. Genomic DNA (50 ng) was analysed by real-time PCR (Section 2.2.5). The primer sets used are summarised in Table 2.6.

CHART-PCR primers Product size

-555 Forward CACAGCTCTTGCAGCAGGTA 106 bp -555 Reverse GCGCAGAATGACCAGGTTAG 1hm Forward GCAGCCCCTAGGCACTGTGGT 85 bp 1hm Reverse GCCCCTCCGCAGCCCTTG 2hm Forward GCTCGCCGTCGGATATG 120 bp 2hm Reverse CACCTTGGCTCCCGTACAGC

50 -126 Forward CTGTACGGGAGCCAAGGTG 112 bp -126 Reverse GCAAACACCGGATCTGCTC 52hrm#2 Forward GGTGTTTTGCGGAATCAG 78 bp 52hrm#2 Reverse AGCAGGGAAAAGTTTC 3hm Forward GAAACTTTTCCCTGCT 77 bp 3hm Reverse AGGGATACGAGAACCTGCAC +210 Forward GTCAAGGTAAGCGGGGATTT 95 bp +210 Reverse CTCCCTAGTTCCGCCCAAT

Table 2.6 CHART-PCR primer sequences

2.9.2 Chromatin immunoprecipitation assay (ChIP)

DNA-protein interactions were examined by ChIP analysis. LNCaP, 22Rv1 and PC3 (5 x 106 cells) were treated with 1% formaldehyde for 15 minutes with agitation at room temperature to crosslink the proteins and DNA then quenched by addition of 0.125 M glycine and incubated for 10 minutes with agitation. Cells were then pelleted by centrifugation at 500 g for 5 minutes and washed twice with ice cold PBS. Cell pellets were resuspended in 1 mL lysis buffer (20 mM Tris-HCl pH8, 8.5 mM KCl, 0.5% Igepal) and incubated on ice for 10 minutes. After cell lysis, nuclear extracts were pelleted by centrifugation at 500g for 5 minutes, washed twice with ice cold PBS. Nuclei (9 x 106) were lysed with 250 µL of nuclei lysis buffer (1% SDS, 10 mM 0.5M EDTA, 50 mM 1M Tris pH8) and incubated for 10 minutes on ice. Nuclei were sheared into 100-500 bp fragments by sonification on high power setting and two runs of 10 times (30 seconds ‘on’, 30 seconds ‘off’) with a Diagenode Bioruptor sonicator (Diagenode, USA), as determined empirically. The solute was pre-cleared for 2 hours at 4 ºC on a rotating wheel with 1 mL ChIP dilution buffer (0.01% SDS, 1.2 mM EDTA, 16.7 mM Tris-HCL pH8, 1% Triton X-100, 167 mM NaCl) and 60 µL salmon sperm DNA/protein A agarose slurry (Millipore, USA). Solubilised chromatin was immunoprecipitated with 1.8 µg anti-

51 H3 (1791 Abcam, USA) and 4 µg anti-acetyl H3 (06-599 Millipore, USA) by incubating overnight at 4 ºC on a rotating wheel.

The immune complexes were recovered using 60 µL salmon sperm DNA/ protein A agarose for 4 hours at 4 ºC on a rotating wheel and then pelleted by centrifugation at 2000 g for 1 minute at 4 ºC and the supernatant discarded. The slurry was the washed with 1 mL each of low salt buffer (2 mM EDTA pH 8, 0.1% SDS, 1% Triton X-100, 20 mM Tris-HCl pH 8.1, 150 mM NaCl), high salt buffer (2 mM EDTA pH 8, 0.1% SDS, 1% Triton X-100, 20 mM Tris-HCl pH 8.1, 500 mM NaCl), washed twice with LiCl buffer (1 mM EDTA pH 8, 10 mM Tris-HCl pH 8.1, 250 mM LiCl, 1% Igepal, 1% sodium deoxycholate) and washed twice with TE buffer (1 mM EDTA pH 8, 10 mM Tris-HCl pH 8.1). DNA/ protein complexes were eluted from the slurry with 200 µL of elution buffer (100 mM NaHCO3, 1% SDS), incubated on a rotating wheel for 15 minutes at room temperature and the slurry pelleted. To reverse the cross-links, 0.2 M NaCl was added to the supernatant and the proteins were degraded with proteinase K (Qiagen, USA) treatment overnight. DNA was purified by phenol/chloroform extraction (50% phenol, 50% chloroform), followed by ethanol precipitation for at least 4 hours and resuspended in 50 µL MilliQ water. DNA (5 µL) was amplified using real-time PCR (Section 2.2.5) and levels determined as a percentage of the total input DNA with no antibody control immunoprecipitates were analysed in parallel. The -555 and the 3hm primer sets (refer to Table 2.6) were used to analyse regions of the ITGA2 promoter.

2.9.3 Nucleosome occupancy and methylome sequencing (NoMe-seq)

Analysis of both nucleosome occupancy and DNA methylation on the same DNA was undertaken by NoMe-seq (You et al., 2011). Nuclei were extracted by modification of a previously published method (Schreiber et al. 1989). Briefly, cells were trypsinised and centrifuged for 3 minutes at 500 g. Cell pellets were washed in ice-cold PBS and resuspended in 1 mL ice-cold Nuclei Buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1 mM EDTA and 0.5% NP-40, plus protease inhibitors) per 5 x 106 cells, and incubated on ice for 5 minutes. Nuclei were recovered by centrifugation at 900 g for 3 minutes, washed in Nuclei Wash Buffer (10 mM Tris pH 7.4, 10 mM NaCl, 3 mM MgCl2

52 and 0.1 mM EDTA containing protease inhibitors) and resuspended at a concentration of 2 x 105 cells/mL in 1X M.CviPI reaction buffer. Nuclei were treated with 200 U of

M.CviPI for 15 minutes at 37 ºC. Reactions were quenched by the addition of an equal volume of Stop Solution (20 nM Tris-HCl pH 7.9, 600 mM NaCl, 1% SDS, 10 mM EDTA) and genomic DNA was isolated using a QIAamp blood kit (Qiagen, USA) according to the manufacturer’s instructions. Bisulphite conversion was performed using an EZ DNA Methylation-Lightning™ Kit (Zymo Research Corporation, USA; refer to Section 2.3) according to the manufacturer’s instructions and regions of interest were amplified using primers summarised in Table 2.7. PCR fragments were cloned into the pGEMT easy vector (Promega, USA) according to Section 2.4.

Primer Name Primer sequence

-488NoMe Forward 5’ – TTTTTTTATTTATTTAGGAAAAATAGAGAAAGGGA-3’ ITGA2NoMe2 Reverse 5’ – CCCATCCTAAATCTAAC – 3’ GRP78 Forward 5’ – GAGAAGAAAAAGTTTAGATTTTATAG – 3’ GRP78 Reverse 5’ – AAACACCCCAATAAATCAATC – 3’ Table 2.7 NoMe-seq primer sequences