50 pg pC89 (see appendix B for vector diagram) were digested with 100 U of
each of BamHI and EcoRI (Promega) in a total volume of 200 pi, using the
recommended restriction enzyme buffer. Single enzyme digestion controls of 10 pi were carried out in parallel using the same ratios of ingredients. All
samples were incubated at 37°C for 3 hours, after which the progress of
digestion was assessed by electrophoresis using a 1% agarose gel. Once complete digestion had been confirmed, the double digested vector backbone was purified using the QIAquick Nucleotide Removal Kit (Qiagen) - following the manufacturer's instructions - and eluted in 200 pi IE .
40 pi eluate was dephosphorylated with 5 U shrimp alkaline phosphatase
(Roche), using the recommended buffer. Following incubation at 37°C for 1
hour, and enzyme inactivation at 65°C for 20 minutes, DNA was purified as
estimated by subjecting a 5 pi aliquot to electrophoresis on a 1% agarose gel, alongside dilutions of the DNA size and weight marker Hyperladder I (Bioline).
2.3.2 Preparation of insert DNA
Oligonucleotides 010, C10C, P1, P6 and Rev were purchased from Genosys
(Table 2.1). Individual library (010 & C10C) and integrin-targeting (PI & P6) sequences were annealed to the universal reverse primer (Rev) and second- strands synthesised by primer extension: firstly 500 picomoles (pm) of each primer were annealed in 200 pi DNA polymerase buffer (Promega) by heating to 94°C and cooling to 22°C over 30 minutes. 0.2 mM dNTPs, 0.1 mg/ml acetylated BSA and 50 U Klenow DNA Polymerase (Promega) were then added, to make a total volume of 220 pi, and primers extended 37°C for 30 minutes. NAME C7C C10C P1 P6 Rev SEQUENCE GCGGAATTCGGCTGC (NNK) ^TGCGGCGCGGATCCACCG GCGGAATTCGGCTGC (NNK) loTGCGGCGCGGATCCACCG GCGGAATTCGGCGCCTGCCGTGGCGATATGTTCGGCTGCGGCGCGGATCCACCG GCGGAATTCGGCGCCTGCCGTCGTGAAACCGCCTGGGCCTGCGGCGCGGATCCACCG CGGTGGATCCGC
TABLE 2.1 Phage display oligonucleotides: Forward (070, 0100, P1 and P6) and reverse (Rev) primers that were used to generate random peptide libraries and integrin-targeting control phage. EcoRI and BamHI restriction enzyme sites are shown in green and blue respectively. Variable insert regions are shown in red.
Incubation at 75°C for 15 minutes was then performed to stop enzymatic reactions.
For restriction digestion of double-stranded oligonucleotides, 70 U of each of
BamHI and EcoRI were added in a total volume of 400 pi appropriate buffer.
Single enzyme control digestions were set up in 10 pi, and all samples
incubated at 37°C for 3 hours. 350 pi of the double-digested samples were
then spun through a Microcon YM-10 spin column (Millipore; 20 bp cut-off for
dsDNA) and eluted in 50 pi H2O, following the manufacturer’s instructions.
1 pi loading buffer (6x) was added to 5 pi of each of: annealed, single
stranded, undigested, single enzyme-digested, double-digested and purified DNA. Samples were loaded onto a vertical 20% polyacrylamide gel alongside 5 pi of the 25 bp Ladder (Promega) and subjected to gel electrophoresis at 150 V for 1 V2 hours. The gel was incubated in TBE + 0.2 pg/ml EtBr for 15
minutes and visualised under UV.
As the spin column proved ineffective in removing the small end-fragments
resulting from restriction digestion, the remaining 45 pi of double-stranded insert DNA was loaded into a single large well of a 2-well comb (Biorad) and electrophoresis carried out as described above. To minimise DNA damage due to UV exposure, the gel was sliced approximately 1 cm from the left edge and only the smaller gel slice incubated in EtBr and exposed to UV (Figure 2.1). Using the exposed region as an indication of where the double-digested insert band had migrated to within the larger gel slice, this invisible band was excised from the gel. Gel purification was carried out by crushing the gel using the back of a disposable inoculating loop, followed by incubation in 3 ml
0.5 M NH4AC at 37°C with shaking overnight. Gel fragments were then
removed by centrifugation at 3,000 x g and the supernatant filtered through
silanised wool. Repeated 1-butanol extractions were applied to reduce the volume to 0.5 ml, and protein removed by phenokchloroform extraction,
followed by DNA purification using ethanol precipitation (see appendix A for
methods). The DNA concentration in this final sample was estimated by
loading a 10 pi sample next to dilutions of the DNA size and weight ladder
HyperLadder IV (Bioline).
A
B
FIGURE 2.1 Diagram m atic representation o f gei extraction; Insert DNA and the 25 bp DNA ladder were loaded into large and small wells respectively of a polyacrylamide gel and subjected to vertical gel electrophoresis. To avoid damaging DNA by exposure to UV the gel was cut as shown above and only section A stained in EtBr and exposed to UV. The position of the sample band was marked on section A and used to excise the appropriate region from section B.
2.3.3 Ligation and transformation of iibraries
The optimal molar ratio of insert:vector was determined by testing a range of ligation ratios and counting the resulting percentage of blue colonies following transformation into XL2-blue Eco// cells. The optimal ratio of 2.5:1 was then
used. For C7C and C10C libraries, 2 pg of vector DNA, the appropriate
amount of insert DNA and 6 U T4 DNA ligase (Promega) were added in a total volume of 40 pi. For peptide control phage, 500 ng vector DNA and 3 U DNA ligase were used in 20 pi total volume. Insert-free and insert-ligase-free controls were used to estimate background levels of vector re-ligation and uncut vector DNA respectively. Ligations were performed at 14°C overnight, followed by heat-inactivation at 65°C for 15 minutes. Prior to transformation, samples were purified by dialysis against ddH20 using 0.05 pm nitrocellulose membranes (Millipore).
A total of 1 pg of the C7C library was transformed into 17 aliquots of 100 pi XL2-blue heat shock competent cells (Stratagene) according to the
recommended protocol. Transformations were pooled into 20 ml SOC
medium, incubated at 37°C with shaking for 1 hour and spread onto 14 large
bioassay plates (24.5 x 24.5 cm; Nunc) containing LB agar + Amp (100
pg/ml). 300 ng of the C10C library were transformed into 12 aliquots of 50 pi
TGI electrocompetent cells (Stratagene), pooled, incubated and plated onto 24 large plates, as described above. Phage controls were transformed into XL2-blue heat shock competent cells prepared in the lab (appendix A).
To determine the number of independent clones and the percentage of blue colonies, ten-fold dilutions of library transformations were plated onto
standard LB + Amp (100 pg/ml)/Bluo-gal (40 pg/ml)/IPTG (0.5 mM) plates. All
plates were incubated at 37°C overnight. Bacterial cells were scraped from large plates containing library phage, re-suspended in 50 ml TB + 15% glycerol and stored as 2 ml aliquots at -70°C. For phage controls, blue colonies were picked and analysed by PCR and sequencing (section 2.6). Glycerol stocks were made of verified clones and stored at -70°C (appendix A).
2.4 Phage amplification and purification