The crRNA loaded Csa2-Cas5a complex recognises and binds target DNA

The next functional step in the process of viral interference of the E. coli

CASCADE is the RNA-guided sequence specific targeting of invading DNA, and subsequent recruitment of Cas3 to catalyse the degradation of the invader sequence. The Csa2-Cas5a complex was assayed for similar activity by investigating its affinity for a radiolabelled target DNA in the presence or absence of crRNA. In the absence of crRNA-A1, the affinity of the complex for a ssDNA target was minimal (figure 4.18 A). Nevertheless, when Csa2-Cas5a was incubated with an excess of crRNA, the ribonucleoprotein complex formed was able to recognise and shift a labelled ssDNA complementary to the spacer A1 in the crRNA (substrate tA1f, table 4.3, figure 4.18 A) with an apparent dissociation constant of 750 nM. The recognition is mediated by the basepairing of the central spacer region of the crRNA and tA1f oligonucleotides, resulting in the formation of DNA-RNA heteroduplex and a stable ternary complex with Csa2-Cas5a. The reverse complementary DNA strand (tA1r), containing the spacer A1 sequence, was not gel-shifted by the crRNA-loaded Csa2-Cas5a complex (figure 4.18 A), indicating that the DNA targeting is entirely dependent on the existence of a region of complementarity between the crRNA and the target DNA and the formation of a heteroduplex. Moreover, the crRNA-Csa2-Cas5a complex did not exhibit affinity for a ssRNA target (RNA_tA1f) complementary to the spacer A1 (figure 4.18 B), indicating that the molecular recognition mechanism is specific for targeting DNA, possibly by interactions with the deoxyribophosphate backbone.

Jore et al. (2011) have demonstrated that the molecular mechanism utilised by

the E. coli CASCADE to recognise invader dsDNA is the formation of an R-loop by basepairing of the protein-bound crRNA with the complementary DNA strand and displacement of the non-complementary strand. The target DNA substrates used in our study were not long enough to observe the formation of an R-loop, although it is possible that a similar mechanism is in operation.

Thus we have demonstrated that the mature crRNAs generated by Cas6 and loaded on the Csa2-Cas5a complex serve as guide RNAs that enable recognition and binding of the invader ssDNA. Predictably we did not observe any cleavage of the bound target DNA by the Csa2-Cas5a complex (figure 4.19). It is hypothesised that in

analogy with the E. coli CASCADE, accessory CAS proteins are recruited to perform

the silencing of the invader DNA. In E. coli this role is performed by Cas3, a predicted

DEAD-box helicase fused to an HD-nuclease in the E. coli CAS system. In Sulfolobus

solfataricus and other CAS systems these two functional domains comprise different proteins, where Cas3 is a DEAH/X-box helicase always encoded next to a protein with

a predicted HD family nuclease domain. It is predicted that both proteins are required

to interfere with virus proliferation, but it is unlikely that they interact physically with the Csa2-Cas5a complex as they were not found among the co-purifying proteins

during native expression. Therefore, in order to reconstruct and study the interference

pathway for S. solfataricus in vitro it is necessary to express these proteins

recombinantly.

Figure 4.18: cr-RNA mediated binding of Csa2-Cas5a to DNA target

(A) Increasing concentrations of Csa2-Cas5a were pre-incubated with 100nM of unlabelled crRNA for 3 min, and 25nM of labelled target ssDNA were added for 10 min at 55o_{C. Products} were analysed on a native 10% PAA gel. Reactions were repeated in triplicate, and typical assay images are presented here. (B) The Csa2-Cas5a complex showed minimal affinity for an RNA target complementary to the pre-loaded crRNA. Assay conditions and substrate concentrations as for (A). (C) Comparative binding of Csa2 and the Csa2-Cas5a complex to the crRNA/DNA target heteroduplex. Assay conditions as in (A). Both Csa2 and the complex display comparative affinity for the DNA target, with a slightly lower apparent Kd for the complex. This confirms that Csa2 is the main subunit responsible for the nucleic acid

0.05 0.1 0.25 0.5 1 2 0.05 0.1 0.25 0.5 1 2 μΜ Csa2-Cas5a Csa2 DNA/RNA heteroduplex bound DNA/RNA C A 0.5 1 2 4 0.25 0.5 1 2 4 0.25 0.5 1 2 4 0.25

target DNA tA1f target DNA tA1r +crRNA-A1 Csa2-Cas5a (μΜ) unbound labelled ssDNA DNA/RNA heteroduplex bound DNA/RNA dsRNA bound dsRNA Csa2-Cas5a 0 0.25 0.5 1 2 4 μΜ B

5’- AUUGAAAG GAACUAGCUUAUAGUUUAGAAGAAAACAAACAAAUAAU GAUUAAUCCCAAAA ||||||||||||||||||||||||||||||||||||||

3’- GTGGAAGAGAGGT CTTGATCGAATATCAAATCTTCTTTTGTTTGTTTATTA GGGATATCACTCAGCATAAT-5’

recognition and interactions, with Cas5a potentially involved in alignment and stabilisation of the heteroduplex. (D) The crRNA/target DNA heteroduplex bound by aCASCADE. Spacer sequence in red, the PAM is underlined and highlighted in blue and the crRNA 5’ psi-tag is in bold.

As will be discussed in more detain in the following chapter, we were able to

obtain a recombinant SsoCas3’ but we were not able to express any of the HD

nuclease orthologues from S. solfataricus, either individually or in co-expression

vectors with Cas3. The protein is either highly unstable or extremely toxic for E. coli,

which leaves native expression in S. solfataricus as the only option.

Figure 4.19: Absence of nuclease activity on DNA protospacer targets by aCASCADE

2μΜ of either recombinant or native aCASCADE were pre-incubated with 100nM unlabelled crRNA_A1 for 5 min at 55o_{C, and the reaction was initiated with the addition of 300nM of ss or} ds protospacer DNA targets and 1μΜ of Csa5 and Cas3 where indicated. Reactions were incubated at 60o_{C for 20min, terminated by Proteinase K treatment for 10min at 37}o_{C and} analysed on denaturing 20% PAA/ 7M Urea gel. Protein components are indicated on the gel. In ds substrates, labelled strand is indicated with an asterisk. Lanes: 1, substrate ss tA1f ; 2, substrate ds tA1f/*tA1r ; 3, substrate ds *tA1f/tA1r ; 4-6, as 1-3 ; 7, substrate ss tA1r ; 8, substrate ss tA1f ; 9, substrate ds tA1f/*tA1r ; 10, substrate ds *tA1f/tA1r ; 11, substrate ds tA1f/*tA1r ; 12, substrate ds *tA1f/tA1r, 13, substrate ss tA1r ; 14, substrate ss tA1f ; 15, control ss tA1r ; 16, control ds *tA1f/tA1r ; 17, control ds tA1f/*tA1r. Some specific substrate degradation can be observed with the ss tA1f substrate and the native aCASCADE in the presence of Cas3 and Csa5 (lane 14), and it could potentially be attributed to sub- stoichiometric amounts of the HD nuclease in the partially purified native sample, but this result could not be confidently repeated.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

72nt

rec Csa2/Cas5a native aCASCADE

4.9.4 The protospacer adjacent motif (PAM) is not required for target DNA