2. Chapter Two Materials and Methods
2.1 DNA methods
2.1.1 Construct introduction
The open reading frame (ORF) of Dyskerin, Ubiquitin-RPS27a or Ubiquitin-RPL40 was cloned in a pcDNA5/FRT/TO vector as described below (Figure 2.1). The pcDNA5/FRT/TO vector contained a FLAG-tag sequence so that all the proteins were expressed with a FLAG-tag on the N-terminus. For RPS27a- and RPL40- ubiquitin fusion ORFs, an HA tag was added to the C-terminus.
2.1.2 Polymerase Chain Reaction (PCR) for cloning
The ORF of each construct was amplified by Polymerase-Chain Reaction (PCR) using the Phusion DNA Polymerase (New England Biolabs) in order to create PCR products with blunt-ends. A cDNA library of the total mRNA, made using a reverse-transcription (RT) PCR (discussed later), was used as a template in all cases. A final concentration of 1x HF (High-Fidelity) Phusion Buffer (New England Biolabs) was used in a 50 µl reaction, along with 200 µM dNTPs, 1 µM of each of the Forward and Reverse primers (Table 2.1), approximately 100 ng of the template DNA and 0.5 µl of the Phusion Polymerase (New England Biolabs).
The PCR conditions (Table 2.2) were according to the manufacturer’s instructions, where the annealing temperature was 3°C below the primer melting temperature (Tm).
Name Forward primer (5’ to 3’) Reverse Primer (5’ to 3’)
Dyskerin CGCGAGATCTATGGCGGATGCGG AAGTAAT CGCGCTCGAGTCACTCAGAAACCAATTCT ACC RPS27a GATCGGATCCATGCAGATTTTCGT GAAAACCCTTAC 1:GGATAGCCCGCATAGTCAGGAACATCG TATGGGTACTTGTCTTCTGGTTTGTTGAAA CAGTAAGTCAG 2:GCCGTCGACTCATGCATAGTCCGGGAC GTCATACGGATAGCCCGCATAGTCAGGA AC RPL40 GATCGGATCCATGCAGATCTTTGT GAAGACCCTCAC 1:GGATAGCCCGCATAGTCAGGAACATCG TATGGGTATTTGACCTTCTTCTTGGGACG C 2:GCCCTCGAGTCATGCATAGTCCGGGAC GTCATACGGATAGCCCGCATAGTCAGGA AC
Table 2.1. Primers used for cloning.
2.1.3 DNA visualization and extractions
The PCR products were diluted in 6x DNA loading buffer (0.4 % orange G, 0.03 % bromophenol blue, 0.03 % xylene cyanol FF, 15 % Ficoll400, 10 mM Tris-HCl pH 7.5, 50 mM EDTA pH 8.0), to a final concentration of 1x. Products bigger than 500kb were loaded on a 1% agarose gel, whereas products smaller than 500kb were loaded on a 2% agarose gel. The agarose gels were made in 1x TBE solution (TRIS/Borate/EDTA: 90 mM Tris-HCl, 90 mM Boric acid, 2 mM EDTA, pH 8.0) with the addition of 1x SYBRSafe dye (Life Technologies). Gels were visualized using a UV transilluminator and the GelDoc system or a Typhoon Phosphorimager. For cloning, DNA was extracted from the agarose gel using the Wizard® SV gel and PCR Clean-Up System Kit (Promega), according to the manufacturer’s instructions. To remove any excess ethanol from the sample after extractions, the samples were dried using the speed-vac for 30minutes.
2.1.4 Ligation in pJET1.2 vector
1 µl of the DNA PCR product (approximately 10 ng) was added to 0.5 µl of pJET1.2 vector (approximately 50 ng) (Promega), with 0.5 µl of T4 DNA ligase (Promega) and 5 µl of 2x Ligase Reaction Buffer (Promega). The mixture was incubated at room temperature for 30 minutes, before being transformed in DH5α E. coli competent cells.
2.1.5 Transformations in Escherichia coli and DNA extractions
Plasmid DNA was transformed into DH5α E. coli competent cells, which were prepared based on the Inoue Method (Brown et al., 2009).Up to 100 ng of plasmid DNA or up to 10 µl of the ligation mixture was added to 100 µl of DH5α E. coli competent cells and placed on ice for 30 minutes. The cells were then heat-shocked at 42°C for 1 minute
Phusion PCR
Step Temperature (°C) Time (sec) Cycles
Initial activation 98 30 1 Denaturation 98 10 20-25 Annealing Tm - 3 30 Extension 72 15/kb Final Extension 72 600 1
Table 2.2. PCR conditions using the Phusion DNA polymerase for cloning.
before they were placed on ice for 1 minute. 1 ml of Luria Broth (LB) (15.5 g LB / 1 L water) medium was added and the cells were incubated at 37°C for 1 hour while shaking. The cells were then centrifuged at 3,000rpm on a benhctop centrifuge for 2 minutes and 900 µl of the LB medium was removed. The cells were resuspended in the remaining LB medium and placed on ampicillin-containing plates overnight at 37°C. One colony was picked up from each plate and added to 3 ml of ampicillin-containing LB medium, which was grown overnight at 37°C. DNA was extracted from the cells using the GeneJet Plasmid Miniprep Kit (ThermoScientific) according to the manufacturer’s instructions.
2.1.6 DNA sequencing
The identity of the plasmids was confirmed by DNA sequencing at GATC Biotech or Source Biosciences. The primers used for DNA sequencing corresponded to the vector sequences upstream and downstream the open reading frame.
2.1.7 Restriction Digest
The cDNA of interest was released, using restriction digest, from pJET1.2 vector for its cloning in the pcDNA5/FRT/TO vector. Approximately 2 µg of DNA was digested with 10 U of the relevant restriction enzymes and buffers (Promega) according to the manufacturer’s instructions, producing sticky-ended products. Table 2.3 summarizes the restriction enzymes used for each of the constructs.
ORF Restriction Enzyme 1 Restriction Enzyme 2
Dyskerin BglII XhoI
RPS27a BamHI SalI
RPL40 BamHI XhoI
Table 2.3. Restriction enzymes used for construct digestion.
2.1.8 Ligation in pcDNA5/FRT/TO vector
The cDNAs were cloned into a modified pcDNA5/FRT/TO vector (Andrew Knox, Nick Watkins, personal communication) (Figure 2.1). A 5:1 molar ration (DNA insert:vector) was used along with 0.3 U of T4 DNA ligase (Promega) in 1x T4 DNA ligase Buffer (Promega). The samples were incubated at 18°C overnight and transformed in DHA5α
E. coli competent cells. DNA was extracted as described above and the samples were
sent for DNA sequencing in order to confirm the construct sequence.
Figure 2.1. The modified pcDNA5/FRT/TO vector used for cloning. Two repeats of
FLAG-tag sequence and six copies of the His-tag sequence were found upstream the cloned cDNA, which was under a tetracycline promoter. On the pcDNA5/FRT/TO vector are shown in order: the CMV promoter, the multiple cloning sites, the BGH reverse priming site and polyadenylation signal (pA), the Flp recombination site (FRT), the Hygromycin-resistance gene, the SV40 early polyadenylation (pA) signal, the pUC origin and Ampicillin resistance gene (From A.A Knox).
2.1.9 Site-directed mutagenesis
Site-Directed mutagenesis was used to introduce mutations in the pcDNA5/FRT/TO- cloned Dyskerin. 200 ng DNA, 1x Pfu Turbo Buffer (Stratagene), 100 ng of each primer (Forward and Reverse) (Table 2.4), 200 nM dNTPs and 2.5 U Pfu Turbo (Stratagene) were added to the reaction, which was performed according to the manufacturer’s instructions. Next, the PCR products were digested with DpnI (Promega) for 1 hour at 37°C in order to remove the template DNA, since DpnI digests the methylated DNA. 5 µl out of the 100 µl reaction were transformed in 50 µl of DHA5α E. coli competent cells. Cells were grown and DNA was purified as described above.
The PCR conditions used were according to the manufacturer’s instructions as described in Table 2.5.