3.1 Introduction
3.1.7 Enhancer elements
A second type of element that can potentiate gene transcription is the enhancer. This is located in the 5’ flanking region of the gene and typically contains a collection of sites which bind activating or suppressing factors to stimulate or depress transcription. Although enhancers lack promoter activity themselves, they may be able to greatly increase levels of gene expression and can be essential for expression. The positive regulatory activity of an enhancer is generally position and orientation independent, as demonstrated by the rhodopsin enhancer region (RER) (Zack et al., 1991).
Transgenic studies have shown that the rhodopsin enhancer region is responsible for high levels of rod opsin expression (Nie et a l, 1996). Sequence comparisons between bovine, mouse, rat and human rod opsin sequences, identified a 1 0 0 base pair region
which showed significant homology (75-85%) between the species (figure 3.6); chicken sequence however, only showed 40-50% homology to this region (Sheshberadaran & Takahashi, 1994). Despite the high sequence homology, the transcription start site of the RER varies between species from around 1.5kb upstream in the mouse to over 1.9kb upstream in bovine (Zack et a l, 1991; Nie et a l, 1996) and, in addition to its transposition further upstream, the RER of bovine rhodopsin has
VO LA
c is-E le m e n t
C o n se n su s se q u en c e
//•flrts-Factor
re fe re n c e
TATA box TATA A/T A A/T TATA binding protein (Breathnach & Chambon, 1981)
SP 1 GGGCGG SP 1 (Courey & Tjian, 1988)
CCAAT box C C/T AAT CTF/NFl (Rosenfeld & Kelly, 1986),(McKnight
& Tjian, 1986)
Ret 1/PCE 1 CAATTA Crx (Kikuchi et a l , 1993), (Yu &
Barnstable, 1994), ( Y u e t a l, 1996), (Chen et a l , 1997), (Furukawa et a l ,
1997)
Ret 2 TCCAGTCACAGCCTGAGGCCACCAGAGTG unknown (Yu, 1993)
Ret 3 CCTTAAACTGCTGGAGACCAACTTCCAGCC unknown (Yu, 1993)
Ret 4 GGAGCTTAGGGAGGG Crx (Chen & Zack, 1996), (Chen et a l,
1997)
NRE TGCTGATTCAGCC Nrl (Rehemtulla et a l, 1996)
API TGATTCA API (Rehemtulla et a l, 1996)
Proximal j^/ajj-like ACCCCTGAAAATGGC unknown (Sheshberadaran & Takahashi, 1994)
Distal j^/ajj-like CTTTTGCAGGGTTTC unknown (Sheshberadaran & Takahashi, 1994)
CRS-1 CAGCACGCCCCGCCTTCTCCCCG unknown (DesJardin & Hauswirth, 1996)
CRS-2 CTTGGCAACCTGGCAAAGTGCCCCCCTCCCT unknown (DesJardin & Hauswirth, 1996)
CRS-3 CTGGCACTAAGCCCCACCCCA unknown (DesJardin & Hauswirth, 1996)
CRS-4 TGCCCGGGACCACACCTCCTTGCT unknown (DesJardin & Hauswirth, 1996)
CRS-5 GTTCCCAGGGCCCACCTCCCCTCC unknown (DesJardin & Hauswirth, 1996)
CRS- 6 TCCCCGCCCCCCCAG unknown (DesJardin & Hauswirth, 1996)
CRS-7 CCCCACCCACCCGCCA unknown (DesJardin & Hauswirth, 1996)
CRS- 8 GTCTGGCCACCAGGGG unknown (DesJardin & Hauswirth, 1996)
BAT-1 GATTAA Crx (DesJardin & Hauswirth, 1996)
Human CACCCTCCTTCTGGCCATGAGGGTCCACGTCAGAATCA AAC CCTCACCTTAACCT C ATTAGCGTTGGGCATAATCACCA GCCAAGCGCCTTAAACTACGAGAGGCCCCATCCCACCCGCCCTGCCTTAGC -1789 Mouse AGATCTGGGGCTGACCACCAGGGTC AGAATCAGAAC CTCCACCTTGACCT C ATTAACGCTGGTCTTAATCACCAA GCCAAGCTCCTTAAACTGCTAGTGGCCAACTCCCAGGCCCTGACACACATA -1461
R at AGATCTGGGGGTGACCACCAGGGTC ATGTCAGAATCAGAAC CTCCACCTTGACCT C ATTAACGCTGGTCTTAATCACCAA GCCAAGCTCCTTAAACTGCTGGAGGCCAACTTCCAGCCCCTGACACACACA -1418
LC R GA CTTGATCTTCTGTTAG CCCTAATCATCAA TT AGCA -3473
VO Ov
Figure 3.6:
Sequence alignm ents o f bovine, human, mouse and rat rhodopsin enhancer regions w ith the hum an
red/green LCR. Bases which are identical in all four rhodopsin genes are shown in blue. The base position
relative to the transcription start site is shown on the right. The ret-3 binding site is also show n by the bold line.
5 ’ promoter region characterisation
also been inverted (Zack et al., 1991). Further studies of opsin promoter regions using DNase I footprinting, have revealed that parts o f the RER appear to be tissue specific; others are restricted to neuronal tissue or are more ubiquitously expressed. The human red/green locus control region (LCR) (Wang et a l, 1992b) sequence shows homology with the RER and is centred approximately 3.5kb upstream of the transcription start site. The LCR contains a 37bp core sequence, which is highly conserved between human, mouse and bovine DNA, embedded in a 200bp region of 70% identity. Studies by Wang et al. (1999) have shown that identical transcription regulatory proteins bind to the LCR of both red and green opsins in mammals. In further transgenic studies, this entire region was proven to be essential for expression, and deletion or mutation of the LCR leads to a condition known as blue cone monochromacy in humans where there is a combined loss of red and green cone function (Wang et a l, 1992b). It has been proposed that the LCRs and other upstream regulatory elements, including Sp 1, interact with promoters by a looping mechanism which brings them together via protein-protein interactions (Cvekl & Paces, 1992), (Mastrangelo et a l, 1991). Transgene constructs generated with 5.4kb or 470bp (Chiu & Nathans, 1994a) and 3.1 kb or 1.1 kb (Chen et a l, 1994) of the human blue pigment promoter were able to direct expression to the blue cones and even a subset of cone bipolar cells. The efficiency of transgene expression did vary however, suggesting that some additional sequences involved in blue pigment gene expression may be missing from the constructs (Chiu & Nathans, 1994a). A construct containing 6.4kb upstream of the mouse blue visual pigment was later shown to direct blue cone cell specific expression and contained all of the necessary sequence elements for efficient transcription (Chiu & Nathans, 1994b).
Also within the RER, lie the Ret-3 site (Yu, 1993) and a sequence that is homologous to the chicken g/a^^-like binding domain (Sheshberadaran & Takahashi, 1994). The
glass gene, first identified in Drosophila, encodes a site-specific DNA-binding zinc finger protein. Glass is thought to play an important role in development by inducing photoreceptor cell-type specific gene expression in pre-photoreceptor cells from the first stages of their differentiation from a common progenitor cell (Moses et a l,
it confers g/<255'-dependent expression on a reporter gene in developing photoreceptor cells (Moses & Rubin, 1991). Studies of the g/a.y^'-like binding sequence in the chicken have also shown that it exhibits tissue-specific binding properties similar to those in Drosophila, but it remains to be seen if the proteins which bind to this site in the chicken can actually activate gene transcription in a photoreceptor cell-specific mode. Partial homologies to the glass-binding site were also found in the bovine, mouse, human (Sheshberadaran & Takahashi, 1994) onà Xenopus (Batni et a/., 1996) opsin promoter regions but to date, their role in transcription is undetermined.