• No results found

EXPERIMENTAL METHODS 2.1 Library screening.

A m ouse genom ic lib ra ry (S tratagene, m ouse liver genomic library in the cosmid pWE 15 vector) was screened at m oderate stringency using an a^^P-dATP 289bp cDNA probe. The probe was derived from a 600bp cDNA product generated from NG108-15 mRNA using 5' RACE PGR (M cIntyre et al.

1993). The primers B2R 197 (GACATCACCGGCCAGCCCTTG) and B2R 198 (GGTGACGTTGAACATTTCGAT) were used to PGR amplify the cDNA. The PGR product was labelled by a random prim ing m ethod using the Stratagene Prime-It kit.

Replica filters were prehybridised overnight at 42°G in buffer containing 5x SSG (Ix SSG = ISOmM NaGl, 15 mM sodium citrate, pH 7.5), 0.1% SDS, 50% form am ide, 5x D enhardt's reagent, 500gg/m l d enatured salmon sperm DNA. Following prehybridisation, the labelled probe was denatured by boiling for 5 m inutes, quenched on ice for 1 m inute and added to a concentration of 1x10^ dpm /m l. Hybridisation was carried out overnight at 42°G. The filters were washed twice in 2x SSG; 0.1% SDS at room tem perature for 20 m inutes and twice in Ix SSG; 0.1% SDS at 55°G for 30 minutes. The filters were dried by blotting and exposed to X-ray film for betw een 5-10 days at -70°G. Golonies th a t hybridised to both replica filters were picked and fu rth e r screened at higher stringency (washed in O.lx SSG; 0.1% SDS at 55-65°G).

2.2 Mapping and sequencing.

A single positive clone was purified, m apped and probed u sin g th e 2 8 9 b p cDNA ra n d o m p rim e d p ro b e a n d oligonucleotide probes labelled with a^^P-dATP by 3’ tailing. This clone was nam ed cosmid A. The prim ers B2R 197 and B2R 198 were used to make the oligonucleotide probes. B2R 197

respectively, m apped and sequenced using a com bination of the Sequenase version 2.0 kit (United States Biochemical Corp.)

and cycle sequencing using T aq polym erase an d dye

term inators on an Applied Biosystems autom ated sequencer. Double stranded DNA was used for sequencing. The sequence was analysed for consensus transcription factor binding sites

using IBI M a c V e c t o r ™ ^ Eastman Kodak Com pany’s sequence

analysis software for Macintosh, gcg analysis and TRANSFAC analysis. B2R 198 did not hybridise to cosmid A although it did hybridise to cosmid B containing the B2 bradykinin receptor coding domain but missing exon 1 (figure 3.9).

The isolated cosm id (cosm id A) and cosm id B were probed with oligonucleotide probes, labelled with a^^P-dATP by 3’ tailing, of the primers B2R 324 (GCCGGACAAAGAGGAGTG AG), B2R 334 (CTTCCAGGAGCAGGGCATTTG) and B2R 335 (CATGGGCTCATGCACCGACAG), as well as a random prim ed probe, labelled with a^^P-dATP using the Prime-It kit, of a 600bp Xba I fragm ent from the upstream region of cosmid B. The 600bp Xba I fragm ent was shown to hybridise to a 1.4kb Eco RI fragm ent which m apped to the 3’ end of cosmid A. This 1.4kb Eco RI fragm ent was subcloned into pKSII(+). This clone and clone 184, which m apped to the 5’ end of cosmid B, were sequenced using an oligo derived from clone 184 and nam ed B2R 325 ( G AAAGG ACCC AG AT ATAGCTG ). Sequencing was perform ed using the Sequenase version 2.0 kit (United States Biochemical Corp.) and using double stranded DNA.

2.3 Reporter Plasmid Construction.

The primers B2R337 (TGGGGAGGTCTTTCTTTCCCAC) and B2R 317 (GCTCATCTTTCAAGGGCTGGC) were used to generate a 2.6kb PGR fragm ent containing the prom oter region, together with transcription initiation site 1, as defined by 5’ RAGE PGR of NG108-15 RNA (McIntyre et al. 1993), and 31bp of exon 1 of the mouse B2 bradykinin receptor gene. Restriction enzyme sites (Hind III) were included on the 5’ ends to facilitate cloning of PGR products.

This 2.6kb PCR fragm ent was gel isolated and cloned into the vector pGL2_Basic (Promega) to generate the construct pGL2 -2.6/+0.031. A series of deleted prom oter constructs were generated by digesting the original B2 b radykinin receptor prom oter construct, pGL2 -2.6/+0.031, with Nhe I, Bgl II, Pst I and Nco I. The constructs cut with Pst I and Nco I were also digested with Bgl II and blunted. The deleted constructs were religated and nam ed pGL2 -1.3/+0.031, pGL2 -0.58/+0.031, pGL2 -0.20/+0.031 and pGL2 -0.16/+0.031 respectively (figure 2.1).

Two luciferase reporter gene constructs were generated by the addition of Ikb of dow nstream sequence onto pGL2 -1.3/+0.031 and (the equivalent of) pGL2 -0.20/+0.031 (figure 2.1). pGL2 -1.3/+0.031 was digested with Bgl II (-0.58kb) and Hind III (3’ cloning site). The resulting co n stru ct was gel isolated from the deleted region and a 1.58kb Bgl II to Ssp 1 fragm ent (-0.58kb to +1.0kb) was ligated into the construct. This construct, nam ed pGL2 -1.3/+1.0, was digested with Mlu 1 (S' m ultiple cloning site) and Pst 1 (-0.20kb), gel isolated from the deleted region and ligated to form the construct pGL2 -0.20/+1.0.

All constructs were checked for the presence of 'in fram e' ATG triplets which could lead to false transcription starts and stops. This w ould lead to a false skewing of th e data. Examination of the B2 bradykinin receptor proximal prom oter dem onstrated th ere were no 'in fram e' ATG triplets presen t (figure 2.2). Furthermore, the dem onstration th at all constructs drove expression to an equal level suggests th a t this was not a problem (figure 3.15).

Figure 2.1 C onstruction o f B2 b rad yk in in recep to r reporter constructs.

Shows the m ethod used to co n stru ct and verify the reporter constructs generated for the deletional analysis of the B2 bradykinin receptor prom oter (section 3.7). The strategy used to create the constructs generated to analyse the effects of the presence of transcription initiation sites 1, 2 and 3 upon prom oter activity (section 3.8) is also shown.

(i) Shows the construction and verification of the initial reporter construct generated, pGL2 -2.6/+0.031. (ii) Shows the construction and verification of constructs pGL2 -1.3/+0.031, pGL2 -0.58/+0.031, pGL2 -0.20/+0.031 and pGL2 -0.16/+0.031. These co n stru c ts w ere g e n e ra te d by d e le tio n of pGL2 -2.6/0.031. (iii) Shows the construction and verification of pGL2 -1.3/+1.0 and pGL2 -0.20/+1.0. The co n stru ct pGL2 -1.3/+1.0 was generated by the addition of Ikb of downstream sequence onto pGL2 -1.3/+0.031. This construct was digested with Mlu 1 and Pst 1, blunted and religated to create pGL2