• No results found

Figure 5.12d Partial sequence of clone 16-3:

Clone 16-3 is probably identical to the human cDNA for E6-AP, a HPV

E6 oncoprotein-associated protein (Huibregtse et al., 1993) which shows

a ubiquitin ligase activity (Scheffner et al., 1993)(Genbank accession no. L07557). 16-3 sequences are in bold.

g t a t a c t t t t . . . . a a g ta g a a a c a g a g a . . a a a t t c t c t t t t a I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1380 TAAAGATTATACTTTT T T C A A A G T A G A A A C A G A G A A C A A A T T C T C T T T T A t g a c a t g t c c c . t t a t a t t g a a t g c t g t c a c a a a g a a t t t g g g . c t a t . t I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 143 0 T GACATGTCCCTTTATATTGAAT G C T G T C A C A A A G A A T T T G G G A T T A T A T t a t g a c a . t a ... I I I I I I I I I 1480 T ATGACAATAGAATTCGCATG 1500

with C R E B using in vitro translation products. It may be reasonable to speculate that clones 14-2 and 14-1, which both correspond to integral membrane proteins (and the clones themselves both encode several putative transmembrane domains), were cloned by virtue of a non-specific interaction of CREB with hydrophobic surfaces exposed in LACZ fusions. Nevertheless, the recent discovery of a nuclear pore protein bearing a leucine zipper (Radu et al., 1994), and the fact that the homology of 14-2 with gp210 appears to fall off towards the 3' end of the clone (fig5.12b), suggests that sequencing of the entire clone might reveal novel sequences capable of mediating the apparent leucine zipper-dependent interaction with CREB. The cloning of E6-AP as a

CREB-interacting protein is also somewhat surprising. E6-AP is required for

the interaction of E6 with p53 (Huibregtse et al., 1993a) which brings about

rapid degradation of p53 by a ubiquitin-mediated pathway (reviewed recently in (Ciechanover and Schwartz, 1994)). The 16-3 clone encodes a region of E6-AP just upstream of the motif shown to be critical for the interaction with E6,

but falls within that region required for the interaction of E6-E6-AP with p53

(Huibregtse et al., 1993b). The E6-E6-AP complex behaves as a ubiquitin

ligase activity (Scheffner et al., 1993). There is no evidence to date for CREB as a target for ubiquitination, and indeed targets for this activity are characterized by rapid degradation, which is not known to be a characteristic of CREB. It is possible that the ubiquitin ligase in this case has recognized a particular conformation of CREB protein as presented under the conditions of the library screen: That is, the enzym e may target non-native protein conformations for destruction.

5.4 Discussion

Despite the difficulties encountered during the work undertaken in Chapter 4, in detecting the expected interactions of CREB with itself or with ATF-1, I have shown in this chapter that the Far Western method is sufficiently sensitive to enable cloning of both of these factors by expression screening.

Several non-leucine zipper factors were additionally cloned, and although only one of these has been characterized further (clone 16-1 is investigated in Chapter 6), the successful cloning of CREB, A TF- 1 and CREM

permits speculation that all of the factors cloned may participate in genuine interactions with CREB in vivo. It would be interesting to attempt identification of these clones with the CREB-interacting activities catalogued in Chapter 4. Since none of the clones described were isolated more than once it can be concluded that the screen was not exhaustive, and that additional C R EB - interacting factors may be represented in the library.

Chapter 6 Properties of HIC and of the

CR EB -H IC interaction

The identification of clone 16-1 as a novel homeodomain factor, HIC (Homeodomain protein Interacting with £R E B ), was described in Chapter 5. Chapter 6 contains an introduction to some homeodomain properties relevant to

these studies, and describes experiments which were designed to explore the significance of the CREB-HIC interaction.

6.1 Introduction to homeodomain properties

6.1.1 Homeodomain proteins as universai DNA binding factors

The study of development in Drosophila led to the identification of genes controlling pattern formation in the early embryo and specifying the adult body plan. These genes were identified from mutant flies in which segments of the body plan are lost, or transformed into other segments, and are called homeotic genes after the homeotic transformations which they mediate. Many of the homeotic genes were found to share a conserved sequence known as the homeobox, which encodes the BOaa homeodomain.

Homeodomain factors have been found to exist in all species studied and have been assigned a central role in providing positional information during development in organisms as diverse as worms and mammals (H O X genes), as well as in plants and in hydra (Chlorohydra viridissima) - one of most ancient animals with an antero-posterior axis. In addition, homeodomain factors are frequently found to be expressed in a restricted manner in differentiated tissues and in many cases may be a chief determinant of tissue identity through their involvement in tissue-specific transcriptional regulation.

The homeodomain was identified as a motif common to the products of several developmental genes and highly similar to the M AT locus factors involved in specifying yeast mating types. The motif is, in addition, structurally related to the helix-turn-helix (HTH) DNA-binding motif common to prokaryotic repressors (Qian et al., 1989). The structure of the homeodomain has been extensively studied and is illustrated in figure 6.1a, which is taken from

(Kissinger et al., 1990). The HTH motif corresponds to helices II and III, which are separated in virtually all known homeodomains by a tripeptide 'turn'. An additional helical region, helix IV, seen in studies of the solution structure of some homeodomains becomes a rigid extension of helix III upon DNA binding