Chapter 2 Developing methods for molecular detection of endophytic Beauveria
2.2 General Methods
2.2.1
Taxonomic identification of fungal species
For the purpose of PCR primer design, and for experimental screening of plant material to test for
Beauveria spp.colonisation, 35 fungal isolates of multiple species were acquired and cultivated (International Collection of Microorganisms from Plants (ICMP), Landcare Research, Lincoln University and Bio-Protection Research Centre Culture Collection, Christchurch, NZ) (Table 2.1). Genomic DNA was extracted from pure culture of each isolate obtained. Fungi were cultured on sterile cellophane, placed over 10% Sabouraud dextrose agar (SDA, Difco, USA), and incubated for 6 days at 25°C, prior to DNA extraction. Cellophane was aseptically scraped using a surgical blade to obtain pure hyphal tissue. DNA was isolated using the REDExtract-N-AmpTM Plant PCR Kit (Sigma-
Aldrich), according to the manufacturer’s instructions.
To amplify the target fungal ITS region for species identification, the REDExtract-N-AmpTM Plant PCR
Kit (Sigma-Aldrich) master-mix was prepared according to the technical manual, with each 20 µL volume reaction consisting of: 10 µL of the kit Hot Start PCR mix, 0.8 µM of each primer (ITS5_F: GGAAGTAAAAGTCGTAACAAGG and ITS4_R: TCCTCCGCTTATTGATATGC White et al. (1990)), and 4 µL of gDNA suspended in the kit elution buffer. Amplifications were carried out in a Veriti 96 well Thermal Cycler (Applied Biosystems) with the following cycling conditions: step (1) 95°C for 5
minutes, step (2) 30 cycles consisting of: 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute; step (3) 72°C for 7 minutes. The quality and size of the PCR products were assessed by agarose gel electrophoresis, using a 1% gel in 1× TAE (40 mM Tris-OH, 20 mM Acetic Acid, pH 7.8, 1 mM ethylenediaminetetraacetic acid (EDTA)). The REDExtract-N-AmpTM Plant PCR Kit contained an inert loading dye in the mix, so 5 μL of each PCR product was loaded in the agarose gel containing a DNA
gel stain (0.5 x RedSafeTM), together alongside 7 μL of a 1 kb DNA ladder (Hyperladder II, Bioline, USA)
and including the negative-template control (NTC) water. PCR products were separated by
electrophoresis in 1× TAE buffer at 100 V for 30 minutes and then visualised following exposure to UV light using the Versadoc Imaging Systems Model 3000 (Bio-Rad, USA).
PCR products were sequenced in one direction (5’-3’) to confirm species identity (Sanger sequencing, Lincoln University Sequencing Unit, New Zealand). Species identity was then confirmed by alignment of these nucleotide sequences of the ITS region in MEGA version 5 (Tamura et al. 2011) along with
those obtained in the GenBank database using the Basic Local Alignment Search Tool (BLAST; Altschul et al. (1990)). Additionally, the amplicon sequences were trimmed to 384 nucleotide base-pairs (bp) in length following the alignment and compared using the Maximum-Likelihood method by (Tamura and Nei 1993) (see Appendix A).
Table 2.1. Table of fungal isolates used in this study.
Isolate Species Host (insect/plant)1 District Isolated by
BG11 Beauveria bassiana Taraxacum officinale dandelion root Christchurch A. Clousten E1063 B. bassiana Vespula germanica (Hymenoptera:
Vespidae) Nelson N. Cummings E1069 B. bassiana V. germanica Nelson N. Cummings
FBHU B. bassiana Selwyn A. McKinnon
FDB B. pseudobassiana Coleoptera: Coccinellidae Selwyn D. Bienkowski
FRh2 B. bassiana Hylastes/Hyalurgis Riverheads S. Reay E1079 B. caledonica Dermaptera Nelson N. Cummings F532 B. caledonica
FRh1 B. caledonica Hylastes/Hyalurgis Riverheads S. Reay NC142 B. caledonica Prionoplu reticularis (Coleoptera:
Cerambycidae) Westland N. Cummings NC44 B. caledonica n.d. Taupo N. Cummings NC49 B. caledonica Coleoptera Taupo N. Cummings Bweta B. malawiensis Hemideina crassidens Westland N. Cummings E1059 B. malawiensis Vespula vulgaris (Hymenoptera: Vespidae) Westland N. Cummings E1060 B. malawiensis V. vulgaris Westland N. Cummings NC215 B. malawiensis V. vulgaris Westland N. Cummings NC220 B. malawiensis Orthoptera: Tettigoniidae Westland N. Cummings NC222 B. malawiensis Vespula sp. Westland N. Cummings E1067 B. pseudobassiana Vespula sp. Nelson N. Cummings E1080 B. pseudobassiana Coleoptera: Scarabaeidae Nelson N. Cummings E1083 B. pseudobassiana n.d. Nelson N. Cummings E1139 B. pseudobassiana P. marginale Nelson N. Cummings E1175 B. pseudobassiana V. vulgaris Nelson N. Cummings NC209 B. pseudobassiana A. zealandica Westland N. Cummings NC120801.1 B. pseudobassiana n.d. Westland N. Cummings NC120826.1 B. pseudobassiana n.d. Westland N. Cummings NC120514.2 B. pseudobassiana n.d. Westland N. Cummings
J1 Alternaria alternata Pinus radiata needle Canterbury J. Brookes
J8 Fusarium oxysporum Pinus radiata needle Canterbury J. Brookes
J10 Aspergillus nidulans Pinus radiata needle Canterbury J. Brookes
J182 B. bassiana Zea mays L.leaf Canterbury J. Brookes
LU132 Trichoderma atroviride
C14 Metarhizium
anisopliae n.d. Canterbury M.C. Lefort
ICMP 11019 Lecanicillium lecanii Cecidophyopsis ribis Westwood (mite) Timaru W Thomas ICMP 14476 Verticillium dahliae Vitis vinifera L. (Rhamnales: Vitaceae) Marlborough M.
Braithwaite
1 Note: n.d. = not determined, absent information indicates soil or other source for isolation.
2 Note: Although isolate J18 (in bold) is included in the table, this isolate was acquired after the plant screening commenced.
2.2.2
Conidial suspensions for inoculation
Inocula were prepared as conidial suspensions for direct application to roots of maize seedlings. Suspensions were produced from cultures grown on potato dextrose agar (PDA; Difco, BD, USA) after three weeks at 20°C. Five mL of sterile 0.05% (v/v) Tween 80 was added to each plate (with five plates per isolate), scraped gently with a hockey stick to blend conidia and then poured through two
layers of Miracloth™ (Merck Millipore) to obtain 25 mL of conidial suspension per isolate. The concentration of conidia per mL was calculated based on counts made from 10 µL of a 10-2 dilution
placed on a Neaubauer hemocytometer counting chamber. Conidial concentrations were then adjusted in 0.05% Tween 80 based on the hemocytometer calculation to achieve 107 or 5 x 107
conidia mL-1, respectively, with the volume depending upon the experiment.
To check the viability of conidia for each isolate, 100 μL of a 10-5 dilution from each suspension was
spread onto PDA, with three replicates per suspension and incubated for 10 days at 20°C. After 10 days, the number of colony forming units (CFUs) were counted. The average number of viable conidia per isolate was multiplied by 10 to get CFU/mL, and then the CFU/mL values were multiplied again by 105 to estimate the quantity of viable conidia per mL of original suspension. By this method,
the percentage of viable conidia for each isolate suspension was above 94%.
2.2.3
DNA isolation from plant material
Maize
Maize (Zea mays) were grown from seed of cultivar Pioneer 34H31. Seeds were first surface sterilised by soaking them in a 2.5% sodium hypochlorite (NaOCl) and 0.02% Tween 80 solution for seven minutes, followed by two washes in sdH2O, with one minute per wash. Surface sterilisation efficacy
was assessed by rolling a subset of 10 surface sterilised seeds onto 10% potato dextrose agar (PDA), and then these ‘imprinted’ control plates were incubated for 14 days at 25°C to check for growing cultures (Schulz et al. 1998). Genomic DNA was obtained from 6 day old seedlings, from root material and following inoculation, using the MO BIO PowerPlant® Pro DNA Isolation Kit, according to the kit protocol but with the following modification: tissue lysis was conducted with the FastPrep-24™ (MP Biomedicals) at 5 m/s for 40 seconds.
Onion epidermis
Single epidermal layers were asceptically peeled from brown onions (Allium sp.) and cut with a sterile blade into 1 cm2 pieces. These pieces were rinsed for 20 seconds in 70% ethanol, followed by 1
minute in sdH2O, and then placed in pairs on 1% bacteriological agar (Difco, BD, USA) immediately prior to inoculation. All epidermal pieces were inoculated prior to DNA isolation with 40 μL each of a
5 x 107 CFU mL-1 conidial suspension prepared from sporulating cultures B. bassiana isolate BG11. For
each genomic DNA extraction, two epidermis pieces were used per sample, following treatment, and DNA was obtained using the MO BIO PowerPlant® Pro DNA Isolation Kit, as described for maize.
2.2.4
Amplification of plant genomic DNA
For amplification of genomic DNA (gDNA) obtained from plant tissues (maize, onion), the reagent concentrations for the PCR master mix, for 25 µl volume reactions, consisted of: 1.5 U/reaction Fast
Start Taq DNA polymerase (Roche Diagnostics GmbH, Mannheim, Germany), 1 X buffer, 2 mM MgCl2,
0.2 mM deoxynucleotide triphosphate (dNTP) (Roche Diagnostics GmbH), 0.2 X bovine serum albumin (BSA, Sigma-Aldrich), 0.4 mM of each primer and 2 µL of eluted DNA. Universal forward and reverse primers were used to amplify plant chloroplast gDNA, psbA3_f (5’-
GTTATGCATGAACGTAATGCTC-3’) (Sang et al. 1997) and trnHf_05 (5’-CGCGCATGGTGGATTCACAATCC- 3’) (Tate and Simpson 2003). Cycling conditions for PCR amplifications were as follows: step (1) 95°C for 5 minutes, step (2) 35 cycles consisting of: 95°C for 30 s, 63°C for 30 s, 72°C for 1 minute; step (3). 72°C for 7 minutes. Negative-template controls were included in all amplifications. PCR products were visualised on 1 % TAE-agarose gel as previously described, to check band size and purity, and secondary products were sequenced in one direction (5’-3’) to confirm species identity (Sanger sequencing, Lincoln University Sequencing Unit, New Zealand).