• No results found

2 Materials and Methods

2.6 Genetic methods

2.6.1 DNA Agarose Gels

A 1% (w/v) agarose/TBE gel was prepared and 2.5 µl 10 mg/ml ethidium bromide added prior to pouring into a mould. A comb was inserted and the gel allowed to set for 15 minutes at room temperature. 1 µl loading dye was combined with 5 µl DNA sample on petrifilm and loaded into the gels. A 1kB+ DNA ladder was used as a marker (Invitrogen™). The gels were run at 110- 115 V and visualised using the GelDoc™ XR+ molecular imager (BioRad™) and ImageLab version 3.0 software system.

2.6.2 Polymerase Chain Reaction (PCR)

Reaction mastermix was produced using the ratios provided in Table7. A negative control was

prepared where 1 µl DAPQ water replaced the cells. Primer sequences used during this study are provided in Table 8.

The PCR cycling conditions used to amplify both genes is given in Table 9. The reactions were performed using an MJ Research PTC-100 programmable thermo cycler (MJ Research Inc).

Table 7 – Reaction mix used for colony PCR reactions Stock Concentration Volume (µL) DNA - Cells Buffer 10x 5 MgCl2 25 mM 3 dNTPs 200 µM 1

Recombinant TAQ polymerase

(Invitrogen™) - 0.5

Primer A 1 mg/ml 0.5

Primer B 1 mg/ml 0.5

dH2O - 39.5

Final Volume 50.0

Table 8 – Primer sequences of bfpA and perA

Target Gene Primer Sequence

bfpA (F) 5’ – TTTTCTTGGTGCTTGCGTGTCT – 3’ (R) 5’ – CATATAATACGCCCAAAACAG – 3’ perA (F) 5’ – TCTGAAAATAAACAAGAG – 3’ (R) 5’ – TGTGTAATAGAATAAACG – 3’

Table 9 – PCR cycling conditions used for all PCR reactions

Stage Temperature (°C) Time Number of cycles

Initial Denaturing 95 10 minutes 1

Denaturing 95 1 minute

25

Annealing 48 1 minute

Extension 72 1 minute 15s

2.6.3 Pulse Field Gel Electrophoresis (PFGE)

Production and processing of plugs was based on the methods described in Smith et al and Brett et al [248, 249].

2.6.3.1 Reagents 20x TE Buffer

4.22 g Tris-base (Sigma-Aldrich) was dissolved in 4 ml 0.5M EDTA, and made up to a final volume of 1 litre using distilled water. The pH was adjusted to 8.0 and the buffer was sterilised by autoclaving.

Pett IV Buffer

58.44 g sodium chloride was mixed with 10 ml 1M Tris-HCl (pH 7.6) and made up to a total volume of 1 litre using distilled water. Pett IV buffer was sterilised by autoclaving and stored at 4°C.

ESP Buffer

4 g N-lauroylsarcosine (Sigma-Aldrich) was shaken vigorously with 400 ml 0.5M EDTA. 200 mg Proteinase K was added and incubated at 37°C for 2 hours. ESP buffer was stored at -20°C in 20ml aliquots until required.

Agarose for Plugs

A 1.6% agarose solution was prepared using InCert agarose (Alphatech) and distilled water. Molten agarose was tempered to 50°C in a waterbath prior to use.

DNA Staining Solution

7.5 µl ethidium bromide (10mg/ml) was added to 150 ml 0.5% TE buffer.

2.6.3.2 Plug Preparation

Using a fresh culture grown overnight on LA, sufficient growth was resuspended in 1 ml Pett IV buffer to a density of 1 McFarland Standard. Cells were pelleted by centrifugation at 6710 x g for

2 minutes in a microcentrifuge (MiniSpin plus, Global Science). The supernatant was discarded and the cells resuspended in 150 µl fresh Pett IV buffer with 2 µl Proteinase K (Invitrogen™). 150 µl molten 1.6% InCert agarose was added and mixed gently to avoid the formation of air bubbles. The mixture was transferred to the plug mould and left at 4°C for 15 minutes to 1 hour until the agarose had set. Plugs were removed from the mould and manipulated into sterile polycarbonate bijoux tubes using a sterile plastic inoculation loop. 1-2 ml ESP buffer was added to each tube and the samples incubated in a waterbath at 50°C for 18 hours. The buffer was removed and replaced with 50 ml 1x TE buffer in a sterile conical bottomed falcon tube, with incubation at 4°C overnight. Using a screw-on sieve cap the buffer was drained and replaced with 50 ml fresh 1x TE buffer with a further overnight incubation at 4°C. The buffer was discarded and replaced with 30 ml 1x TE buffer, with incubation for at least 3 hours at 4°C. Prepared plugs can be stored for up to 5 years at 4°C conditions in 1x TE buffer [248, 249].

2.6.3.3 Restriction Enzyme Digest

The plugs were removed from TE buffer and transferred onto parafilm. Each plug was cut to the desired size using a glass coverslip with the comb as a size guide. Using a plastic inoculation loop the plug fragment was manipulated into a sterile eppendorf tube. 100 µl of enzyme reaction mix was added to each tube and incubated overnight at 37°C. An example of the reaction mix calculation is provided below:

Total volume (buffer and dH20) = 100µL (volume per plug) x Number of plugs

Using the total volume, the required volumes of specific reagents were calculated as follows: Buffer volume = Total volume ÷ 10 (dilution factor)

dH20 volume = Total volume - Buffer volume

2.6.3.4 PFGE

Two litres of 0.5x TBE buffer was prepared using distilled water and chilled. 100 ml 1% (w/v) SeaKem agarose was prepared using 0.5x TBE. 0.8% (w/v) InCert agarose was prepared in sterile water. Both the InCert and SeaKem agarose were tempered to 50°C in a waterbath. The comb was placed horizontally on the casting block and the digested plugs loaded onto the teeth using disposable plastic inoculation loops. Excess buffer was removed using a piece of tissue and the plugs manoeuvred to the bottom of the teeth. The plugs were stuck to the comb using a few drops of the 0.8% InCert agarose, ensuring no air bubbles formed. The agarose was allowed to set at room temperature for 15 minutes. The comb was placed vertically into the casting stand, ensuring the bottom of the teeth was tight against the base of the casting stand. The SeaKem agarose was poured in carefully, avoiding production of air bubbles. The gel was allowed to set for 30 minutes and the comb removed, ensuring the plugs remained at the base of the wells. The wells were filled using the remaining 0.8% InCert agarose. The agarose was allowed to set for 10 minutes before the gel and platform were loaded into the running chamber. Prior to the gel transfer, the chamber of the CHEF-DRII (BioRad™) had been rinsed with distilled water and filled with 2 litres of pre-chilled 0.5x TBE buffer. The mini-chiller was turned on and the buffer chilled to 14°C ensuring no air bubbles were running through the equipment. Once the gel was placed in the chamber frame the pump was turned to a speed setting of 90, to ensure a constant buffer flow that did not displace the gel. The following parameters 4 V/cm, 30 hours, 5-35 seconds were used to separate the DNA fragments. Once completed, the gel was placed in the ethidium bromide stain solution and left at room temperature in the dark for 30 minutes. The gel was then transferred to 0.5x TBE buffer to destain and left at 4°C for 30 minutes. Images were taken using the GelDoc™ XR+ molecular imager (BioRad™) and ImageLab version 3.0 software system.