In vitro systems

2.2.1 Adult muscle fiber isolation

Adult muscle fibers were isolated according to the modified protocol described by Shefer and Yablonka-Reuveni¹⁷¹. Mice were euthanized and rinsed with 70% ethanol. The skin was cut around the ankles and pulled towards the trunk exposing the underlying muscles. The tendons were cut and, by careful pulling to avoid fiber damage, particular muscles (Tibialis anterior (TA), Extensor digitorum longus (EDL), Soleus (SOL), Gastrocnemius (GC) and Quadriceps (QC)) muscles were isolated. After removal of the surrounding connective tissue, muscles were collected in PBS and subsequently transferred to sterile 0.2% collagenase I/DMEM solution (3 ml/50 mg of tissue). The samples were incubated for 1.5 – 2 hours in a shaking water bath at 37ºC until single muscle fibers were loosened. In the mean time, plastic 6-cm Petri dishes were coated with 1 ml of undiluted filtered horse serum (HS) and incubated for 5 min at 37ºC. The HS was removed and the dishes, filled with 7 ml of DMEM, were subsequently stored in the incubator. Muscle digestion was stopped after 2 h by transferring the samples to DMEM-containing coated Petri dishes. The digests were then moved to fresh Petri dishes and single fibers were liberated by gentle trituration through a series of wide bore pipettes rinsed with 10%FCS/DMEM. Individual fibers were lifted with minimal residual medium and distributed into 24-well plates coated with 10% Matrigel/DMEM. Fibers were allowed to settle down for 10 min in the incubator before 500 μl of warm culture medium (20%

FCS/10% HS/1% CEE/DMEM) was added to each well. Single fibers were cultured for 2-3 days until single satellite cells started to migrate off of them and proliferate. The cells were then trypsinized, washed in Hams’ F-10 medium supplemented with 20% FCS, pre-plated for 2 hours on plastic dishes to get rid of the fibroblasts and finally plated on collagen-coated dishes (5 cm Petri dish incubated over night with 0.5 ml of 10% rat tail collagen/0.53% acetic acid and rinsed with PBS).

Alternatively, single fibers were either placed on glass coverslips and immediately processed for immunofluorescence, or cultured on chamber slides and stained at particular time points.

2.2.2 Muscle fiber immunofluorescence

For immunofluorescence analysis, 5 – 7 freshly isolated myofibers were placed on Dako-pen-sealed glass coverslips and fixed for 10 min in 4% para-formaldehyde. After 2×2 min washing with PBS, the samples were incubated in 50 mM NH4Cl/PBS for 5 min, washed in PBS and blocked in 20% normal goat serum/0.5% gelatine/0.5 Triton X-100/PBS for 30 min at room temperature. Primary antibodies were diluted in PBS (eg. rat anti-mouse CD34 1:133) and applied over night at 4ºC. After washing, samples were incubated for 1 hour with matching secondary antibodies, either directly coupled to a fluorochrome or indirectly through streptavidin – biotin

association. Nuclear DNA was counterstained for 10 min with Hoechst dye diluted 1:50 000 in dH₂O and fibers were subsequently mounted in Mowiol 4-88 (Roth).

2.2.3 Neonatal satellite cell isolation

Neonatal satellite cells were isolated from 2-5 days old mice. Animals were sacrificed by decapitation, rinsed with 70% ethanol and de-skinned. Front and hind limbs were isolated and muscle tissue was trimmed of fat. The samples were then incubated with 0.2% collagenase I/DMEM solution (3 ml/mouse) for 1.5 hours in a shaking water bath at 37ºC. Muscle digests were transferred to a series of HS coated Petri dishes filled with DMEM and single fibers were liberated by gentle trituration. Samples were collected in 15 ml tubes filled up with DMEM and centrifuged for 3 min at 300 rpm. The pellet was washed once in PBS and re-suspended in DMEM. Undigested bulk fibers were allowed to settle down by gravity for 2-3 min before the transfer of the supernatant to new 15 ml tubes. After centrifugation at 500 rpm for 5 min, samples were re-suspended in culture medium and plated on Matrigel-coated dishes. Muscle fibers were cultured for 48-72 hours before the satellite cells were harvested and plated on collagen-coated dishes.

2.2.4 Primary mouse myoblast culture

Satellite cells were cultured on collagen coated dishes in growth medium, consisting of Hams’ F-10 medium supplemented with 20% foetal calf serum/2.5 ng/ml basic FGF/50 U/ml Penicillin/ 50 μg/ml Streptomycin, in a humidified 5% CO2 atmosphere at 37ºC. Proliferating cultures were maintained at ~ 40% density with medium changes every 2 days. For splitting, the medium was soaked off, cells washed with PBS and trypsinized for 5 min at 37ºC. Subsequently, they were collected in PBS, centrifuged at 1100 rpm (cell culture Heraeus centrifuge) for 3 min and re-suspended in growth medium. Before being plated on collagen coated dishes, the cells were pre-plated for 2-3 hours on plastic Petri dishes to get rid of the contaminating fibroblasts. Myoblast differentiation was induced by replacing the growth medium with differentiation medium (5%HS/DMEM). During the course of differentiation the medium was changed daily.

2.2.5 Cell immunofluorescence

Cultured cells were fixed in 4% paraformaldehyde/PBS for 10 min, washed in PBS and incubated for 5 min in 50 mM NH4Cl/PBS. After washing in PBS, cells were permeabilized in 0.5%Triton/PBS for 5 min, washed again and incubated for 30 min in 0.5% gelatine/PBS blocking solution. Primary antibodies were applied for 1 h at RT diluted in PBS [anti-LAP2α 245-2 rabbit serum²³ 1:500, goat anti-lamin A/C N-18 (Santa Cruz) 1:100; rabbit anti-MyoD1 M-318 1:500; rabbit anti-NCL-Ki67p (Novocastra) 1:1000; mouse anti-embryonic myosin heavy chain F1.652 and mouse anti-myogenin F5D (Developmental Studies Hybridoma Bank Iowa) 1:10]. Samples were then washed in PBS and incubated with respective fluorochrome-coupled secondary antibodies for 1 h at RT (Texas Red, Cy5 (Jackson Immuno Research) or Alexa Fluor 488 (Molecular Probes)).

After washing in PBS, nuclei were counterstained with Hoechst 33342 dye (1:50 000 dilution in dH2O) for 10 min at RT and washed in dH2O. Samples were air-dried and mounted with Mowiol.

2.2.6 Genotyping and semiquantitative PCR

Genotyping of Lap2α^-/-, Lap2αNeo-fl/Neo-fl and Mdx mice was done as previously described^32,

172. In addition, the following primers were used for genotyping of Cre recombinase and Flipase expressing mice: Cre_sense CCAATTTACTGACCGTACACC; Cre_antisense TAATCGCCATCTTCCAGCAGG; Flp_sense GTGGATCGATCCTACCCCTTGCG; Flp_antisense GGTCCAACTGCAGCCCAAGCTTCC.

Primers used for semiquantitative analysis of PAX7 mRNA expression were Pax7_forw CCGTGTTTCTCATGGTTGTG and Pax7_rev GTGTTTGGCTTTCTTCTCGC¹⁷³. PCR amplification was performed using Go Taq Green Master Mix (Promega) under following conditions: 95ºC 2'/58ºC 1'/72ºC 1'30''/2 × (95ºC 40''/56ºC 1'/72ºC 1')/ 28 × (95ºC 40''/54ºC 45''/72ºC 45'')/72ºC 10'/4ºC∞.

2.2.7 Sirius red collagen staining

Tissue cryo-sections were fixed in ice-cold methanol for 10 min, rinsed with PBS and incubated for 2 min in picro-sirius red solution (0.1% Sirius red F3B in saturated aqueous solution of picric acid). Samples were subsequently washed in two changes of acidified water (0.5% glacial acetic acid/H2O), dehydrated in ethanol (3 changes) and, after clearing in xylene, mounted with Enthelan^® (Merck).

2.2.8 In vitro muscle force measurement

The experiment was performed as previously described¹⁷⁴. Shortly, mice were sacrificed by cervical dislocation and carefully de-skinned. Soleus and EDL muscles were exposed and their size was measured in the native position. Subsequently, cotton threads were placed on the opposing tendons near their bone-attachment sites and the entire muscles were isolated. The samples were kept in Krebs-Ringer solution (118.1 mM NaCl/3.4 mM KCl/2.5 mM CaCl2/0.8 mM MgSO4/1.2 mM KH2PO4/25.0 mM NaHCO3/11.1 mM Glucose/dH2O) during the experiment. Using the threads fixed to their tendons, muscles were suspended between 2 electrodes, respecting their native tension, and the force generated during externally-induced tetanic contraction was recorded.