Materials and Methods
2.3 Insertion Site Amplification using Linker-mediated PCR
2.3.1 DNA template preparation for insertion site amplification
The samples from both control and tumour were treated as follows: Approximately 3mm cubed sample was transferred to an eppendorf tube. 500μl of lyses buffer and 50μl (10mg/ml) of proteinase-K (Bioline Reagents Limited, London, UK) were added, and incubated at 50°C overnight. The mixture was centrifuged at 10,000rpm for 5 minutes. DNA was then extracted using the Qiagen Bio Robot EZ1 machine (Qiagen, Hilden, Germany) according to the manufacturer recommendations and resuspended in 200ul of water. The final concentration of the DNA was measured using a NanoDrop ND-1000 spectrophotometer (Thermo, Wilmington, Delaware, USA), and each sample was adjusted to a final concentration of ~100ng/μl.
2.3.2 First Digestion
For each LM-PCR reaction (Figure 2.1), 2g of genomic DNA was digested with BfaI (left hand side of the transposon) or NlaIII (right hand side of the transposon) in a total volume of 50μl containing 20U of enzyme and 5μl of 10X reaction buffer. Reactions were incubated at 37°C overnight, deactivated by heating at 80°C (BfaI) or 65°C (NlaIII) for 20 minutes, and then purified using a QIA quick PCR purification column (Qiagen, Hiden, Germany). All digestions were resuspended in 35μl distilled H2O, with 15μl of the resuspension being used for quality control on a 1.5% agarose gel as required.
Figure2.1: LM-PCR protocol. (A1 and A2) digestion of sample
DNA with Bfa1 (Left hand side of the T2/Onc “Green”), or NlaIII (right hand side of the T2/Onc “Green”) enymes. (B1 and B2) Ligation with linkers (pink indicates unique single stranded sequence,
black indicates phosphatase splink with hairpin complementarity). (C1 and C2) Further digestion with BamH1 (Lift handside of T2/Onc)
or Xhol (Right handside of T2/Onc) restriction enzyms to eliminate the amplification of T2/Onc elementswhich remain in the transgenic array.(D1 and D2) Primary PCR with a common forward primer “5” and a primer complementary to the unique single stranded sequence in the lift had side of T2/Onc “6” and the right “7” linkers. (E1 and
E2) Secondary PCR using a common nested primer”8” with end specific nested primers “9” for the Lift hand side of T2/Onc or “10”
for the lift, which contain barcoded FLX sequencing primers (see methods). Figure 1.8: Cerebellar anatomic structure: The two main
2.3.3 Splinkerette linker Ligation
For proper splinkerette linker attachment, two BfaI and NlaII linkers were used: Top BfaI oligonucleotide sequence:
5
'
– GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC –3'
Bottom BfaI oligonucleotide sequence:3
'
–AAAAAAACTTTTTTTTTTAATCCGAGGCGAATTCCCTGAT-Phos 5'
Top NlaIII oligonucleotide sequence:
5
'
-GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG-3'
Bottom NlaIII oligonucleotide sequence:
3
'
-AAAAAAACTTTTTTTTTTAATCCGAGGCGAATTCCCTG-Phos 5'
In both cases, the top and bottom primers were annealed (final concentration 100mM in 200mM NaCl) to generate single stranded overhangs complementary to the endonuclease sites (shown in italics). Primers complementary to each linker primer are subsequently used in the primary PCR reaction (sequence underlined). The ligation reaction conditions were as follows: 95°C for 5 minutes as first denaturation, followed by 95°C for 2 minutes, then primer annealing at 52°C for 10 minutes. Linker ligations were performed in a total volume of 20μl per reaction containing 10μl of either BfaI or NlaIII digested DNA, 2μl of 10X buffer, 6μl of annealed BfaI or NlaIII linkers, and 2μl of 800U T4 DNA ligase, and were incubated at room temperature overnight. The ligation reactions were then purified using a QIAquick PCR purification column (Quiagen, Hiden, Germany), and resuspended in 30μl H2O. Where necessary, ligation efficiency was checked using a digest only sample to enable visualisation of ligation products.
2.3.4 Second digestion
using a QIAquick PCR purification column (Quiagen, Hiden, Germany), and resuspended in 30μl H2O.
2.3.5 Primary PCR
Primary PCR was carried out using a splinkerette primer
'
5'
(5'
- GTAATACGACTCACTATAGGGC-3'
), and either a left IR/DR primer (BfaI)'
6'
, (5'
-CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC-3'
), or right IR/DR primer (NlaIII)'
7'
(5'
-GCTTGTGGAAGGCTACTCGAAATGTTTGACCC-3'
) in a total volume of 50μl, containing 3μl of BamHl or XhoI digested DNA, and 47μl of a master mix containing: 0.5μl of 2.5mM'
5'
as a common primer, 0.5μl of either 2.5mM'
6'
primer for BfaI or 2.5nM'
7'
primer for NlaIII, 5μl 10X buffer, 2μl of 50mM MgCl2, 1μl of 10mM dNTPs (2.5mM each) and 0.25μl high fidelity Platinum Taq (Invitrogen, Madison, WI, USA). PCR was performed with an initial denaturation step of 94°C for 2 minutes, followed by 25 cycles of 15 seconds at 94°C (denaturation), 30 seconds at 60°C (primer annealing), and 90 second at 72°C (for extension), followed by a final extension of 72°C for 5 minutes. The PCR products were subsequently diluted 1:75 in H2O to be used in the secondary PCR.2.3.6 Secondary PCR
Secondary PCR was carried out using diluted primary PCR product as a template, and used nested versions of the primary PCR primers carrying both the required fusion sequences for GS20 FLX Pyrosequencing (Fusion L left and right and Fusion B) and a unique 10bp barcode recognition sequence for each sample. Primers were designed such that the nested transposon primer had the Fusion A and barcode attached (Fusion A (Italic) – barcode (bold) – nested SB primer (underlined) in the sequences that follow):
Primer
'
9'
; 5'
CGTATCGCCTCCCTCGCGCCATCAGTCGGAGTCAAGACTTGTGTCATGCACAAAGTAGATGTCC3
'
andPrimer
'
10'
5'
CGTATCGCCTCCCTCGCGCCATCAGTCGGAGTCAATAAGGT GTATGTAAACTTC3'
for left and right, respectively.The nested linker primer has the Fusion B sequence attached (linker nested (Italic) – Fusion B (underline)):Primer
'
8'
;5
'
-CTATGCGCCTTGCCAGCCCGCTCAGAGGGCTCCGCTTAAGGGAC-3'
.The reactions were performed in a final volume of 50μl containing 3μl of diluted primary PCR product (1:75) and 47μl of a master mix containing: 0.5μl of 2.5mM primer '8' as a common primer, 0.5μl of either 2.5mM primer '9' for BfaI or 2.5nM primer '10' for NlaIII, 5μl 10X buffer, 2μl of 50mM MgCl2, 1μl of 10mM dNTPs (2.5mM each) and 0.25μl high fidelity Platinum Taq (Invitrogen, Madison, WI, USA). PCR was performed with an initial denaturation step at 94°C for 2 minutes, followed by 25 cycles of 15 second at 94°C (denaturation), 30 seconds at 60°C (primer annealing), and 90 second at 72°C (for extension), followed by a final extension at 72°C for 5 minutes. 20μl of Secondary PCR products were checked on a 1.5% agarose gel electrophoresed at 90 Volts for 40 min.
2.3.7 Sample preparation for FLX sequencing
Each secondary PCR sample was purified using a QIAquick PCR purification column (Qiagen, Hilden, Germany), and eluted in a final volume of 30μl H2O. DNA quality and quantity was checked using the Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, Delware, USA). Approximately, 100ng/μl DNA of each sample was pooled for FLX sequencing as appropriate, with adjustment to take account of average product size. Pooling was performed to generate on average 500 reads per sample. Samples with less than 100 reads were re-sequenced prior to data analysis. After pooling, a final purification step using a Qiaquick PCR purification column (Quiagen, Hiden, UK) was performed. The samples were diluted to a final concentration of 2 Â 10s molecules/ml for pyrosequencing using the FLX LS20 or Titanium protocols (Roche, Penzberg, Germany). This final dilution, and all FLX sequencing, was performed by Dr Jonathan Coxhead (NewGene Ltd, Newcastle University), according to manufacturer’s recommended protocols.