Laboratory methods

Enrichments and direct culture plating

Before processing, faecal material from each recto-anal mucosal swab sample was weighed (difference between weight of swab with provided Amies transport medium before and after sampling) and recorded to enable enumeration of the concentration of E. coli O157 and O26 in each sample (as described later under Concentration of E. coli in faecal samples). Swab

samples were transferred into 20 ml of buffered peptone water (BPW) (Difco™, Becton, Dickinson and Co, USA) for enrichment, vortexed for 10 s and an aliquot of 50 μl each was

plated onto selective culture media for E. coli O157 and O26 using cefixime-tellurite sorbitol MacConkey agar (CT-SMAC, Fort Richard Laboratories, Auckland, New Zealand) and cefixime-tellurite rhamnose MacConkey agar (CT-RMAC, Fort Richard Laboratories, Auckland, New Zealand), respectively, and an automated spiral plater (Don Whitley, UK; model: WASP2). Culture plates and broths were incubated for 18–24 h at 37°C. Aliquots of

each pre-enriched and post-enriched broth sample were preserved in glycerol (20% (vol/vol) glycerol) and stored at –80°C.

Real-time PCR for detection of E. coli serogroups (STEC and non-STEC)

To improve the efficiency of culture isolation, enriched broth samples were initially screened by real-time PCR for the presence of E. coli O157 and O26 (see further below on testing of sensitivity and specificity of these assays). DNA was extracted from a 1 ml aliquot of enriched broth using 2% Chelex beads solution (Chelex® 100 Resin, Bio-Rad). Previously published primer sequences were used to detect genes encoding for serogroup-specific O- antigens of E. coli (rfbEO157 and wzxO26) (Table 3.2). All genomic DNA extractions were

analysed immediately and then stored at –20ºC.

Table 3.2: Nucleotide sequences of forward and reverse primers used for the detection of specific target genes of E. coli in faecal samples collected from New Zealand slaughter cattle.

Primer set Primer Primer sequence (5’ – 3’)

Target gene

Amplicon

size (bp) Reference rfbE-F TTTCACACTTATTGGATGGTCTCAA rfbEO157 88 [341]

rfbE-R CGATGAGTTTATCTGCAAGGTGAT wzx-F CGCGACGGCAGAGAAAATT wzxO26 135 [341] wzx-R AGCAGGCTTTTATATTCTCCAACTTT A stx1-F GACTGCAAAGACGTATGTAGATTCG stx1 150 [342] stx1-R ATCTATCCCTCTGACATCAACTGC A stx2-F ATTAACCACACCCCACCG stx2 200 [342] stx2-R GTCATGGAAACCGTTGTCAC

A eae-F GACCCGGCACAAGCATAAGC eae 384 [245]

eae-R CCACCTGCAGCAACAAGAGG

A ehxA-F GCATCATCAAGCGTACGTTCC ehxA 534 [245] ehxA-R AATGAGCCAAGCTGGTTAAGCT

B stx2c-F CGACAGGCCCGTTATAAAAA stx2c 243 [269]

stx2c-R GGCCACTTTTACTGTGAATGTATC [267]

C fliC-F TACCATCGCAAAAGCAACTCC fliCH7 247 [343]

fliC-R GTCGGCAACGTTAGTGATACC

C E16S-F AAACGATGTCGACTTGGAGGT 16S 100 In housea E16S-R TGAGTTTTAACCTTGCGGCCG rRNA

a

Enteric Reference Laboratory, Upper Hutt, New Zealand.

mixture for O157 contained 2x PCR buffer (conc. Light Cycler 480 Probes Master, Roche), 50 μM SYTO® 9 dye (green fluorescent nucleic acid stain, Invitrogen), 2 μM of each primer, and 5.4 μl DNA. The PCR included an initial enzyme-activation step at 96°C for 5 min, followed by 45 cycles of denaturation at 96°C for 15 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s; the PCR product was detected by thermal melt from 73°C to 82°C at a rate of 0.1°C per 2 s. Similarly, the final 20 μl PCR reaction mixture for O26 contained 2x PCR buffer (Express qPCR SuperMix, Invitrogen), 50 μM SYTO® 9 dye, 10 μM of each

primer, 2.0 μl DNA, and 5.4 μl sterile water. The PCR included an initial enzyme-activation step at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 10 s; the PCR product was detected by thermal melt from 72°C to 78°C at a rate of 0.1°C per 2 s. Positive and negative template controls were included in each PCR assay.

Testing sensitivity and specificity of real-time PCR assays

The sensitivity and specificity of the real-time PCR assays used for detection of E. coli O157 and O26 respectively in enriched broth samples were assessed. The sensitivity was determined using serial dilutions of enriched faecal broth samples spiked with E. coli O157 and O26. Aliquots of each dilution were taken for DNA extraction and direct plating on CT- SMAC/CT-RMAC culture media to enumerate colony forming units (CFU) at each dilution. The highest dilution detectable by real-time PCR was concluded to be the detection limit of CFU/ml of enriched broth sample. The detection limits for E. coli O157 and O26 were 260 CFU/ml and 198 CFU/ml, respectively.

The specificity of both real-time PCR assays was determined using negative enriched faecal broth samples spiked with E. coli O157 and O26 culture isolates. DNA was extracted from each spiked sample and tested with rfbEO157 and wzxO26 primers. Real-time PCR amplicons

using rfbEO157 and wzxO26 primers were only obtained from samples spiked with E. coli O157

and O26, respectively, while no PCR products were detected in samples spiked with E. coli O157 using wzxO26 primers, and vice versa. The real-time PCR amplicons of E. coli O157 and

O26 were sequenced and showed identical gene sequences for rfbEO157 and wzxO26,

Culture isolation from direct culture plates

Serogroup specific latex agglutination kits (E. coli O157 Latex, Oxoid, UK; Serocheck O26, Oxoid, UK) were used on real-time PCR-positive samples to identify suspected E. coli O157 and O26 colonies from direct culture on selective culture media. Up to 10 non-sorbitol- fermenting and 10 sorbitol-fermenting suspected E. coli O157 colonies per CT-SMAC plate were tested with latex agglutination and, similarly up to 10 non-rhamnose-fermenting and 10 rhamnose-fermenting suspected E. coli O26 colonies per CT-RMAC plate were tested with latex agglutination. Agglutination-positive E. coli O157 and O26 isolates were confirmed with real-time PCR for the presence of rfbEO157 and wzxO26 genes, respectively, to exclude

false-positive latex agglutination results. Confirmed isolates were preserved in glycerol broth (nutrient broth with 15% glycerol) and stored at –80°C for further molecular analysis.

In addition, suspected E. coli O157 colonies from a subset of real-time PCR-negative samples were also tested with latex agglutination to check for false-negative samples. This additional testing to detect false-negative samples was not implemented on suspected E. coli O26 colonies because of the limited availability of the serogroup specific agglutination kit.

Culture isolation using immunomagnetic separation (IMS)

If culture isolation from direct culture plates of real-time PCR-positive samples was unsuccessful, further tests were undertaken. Serogroup specific immunomagnetic beads coated with antibodies against surface antigens of E. coli O157 and O26 (Dynabeads® anti-E. coli O157 and Dynabeads® EPEC/VTEC O26, Invitrogen Dynal AS, Oslo, Norway) were used for isolation of E. coli O157 and O26 from enriched broths, following the

manufacturer’s instructions. A magnetic pen (PickPen®

1-M, BioNobile, Finland) was used for bead extraction. The beads-broth sample suspensions were inoculated onto serogroup specific culture media (CT-SMAC for O157, CT-RMAC for O26) and incubated for 18–24 h at 37°C. Again, up to 10 non-fermenting and 10 fermenting colonies per culture plate were tested with serogroup specific latex agglutination kits. Agglutination-positive E. coli O157 and O26 isolates were confirmed with real-time PCR for the presence of rfbEO157 and wzxO26

genes, respectively, to exclude false-positive latex agglutination results. Confirmed isolates were preserved in glycerol broth and stored at –80°C for further molecular analysis.

Molecular analysis of isolates

Stored E. coli O157 and O26 isolates were re-grown on Columbia horse blood agar (Fort Richard Laboratories, Auckland, New Zealand). Bacterial DNA was extracted from five colonies using 2% Chelex beads solution and was analysed in the following series of PCR assays. All genomic DNA extractions were analysed immediately and then stored at –20ºC.

Multiplex PCR for detection of virulence genes

Confirmed E. coli O157 and O26 isolates were screened by multiplex PCR for the presence of Shiga toxin 1 (stx1) and Shiga toxin 2 (stx2) genes, and other virulence genes including enterohaemolysin (ehxA) and intimin (eae), characteristic of STEC. The multiplex PCR assay was performed on the automated real-time thermocycler, using previously published primer sequences (primer set A, Table 3.2). The final 25 μl PCR reaction mixture contained 2x PCR buffer (Express qPCR SuperMix, Invitrogen), 2 μMof each primer, 2.0 μl DNA, and 2.5 μl sterile water. The PCR included an initial enzyme-activation step at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 20 s, annealing at 64°C for 20 s, and extension at 72°C for 20 s; the terminal extension was at 72°C for 5 min. Amplified PCR products were detected by electrophoresis using a 2% (wt/vol) agarose gel (Agarose low EEO, AppliChem, Germany), stained in ethidium bromide (0.5 μg/ml in TBE buffer) for 10 min, and visualised under ultraviolet light on a transilluminator (GelDoc™ XR, BIO-RAD Laboratories, Segrate (Milan), Italy).

PCR for detection of virulence gene subtype stx2c

E. coli isolates positive for stx2 were tested for the presence of the genetic subtype stx2c. This gene was detected in a separate PCR assay using primer sequences published by Besser et al. [267] and Shringi et al. [269] (primer set B, Table 3.2). DNA amplification was performed on the automated real-time thermocycler with a final 20 μl PCR reaction mixture containing 2x PCR buffer (Express qPCR SuperMix, Invitrogen), 2 μMof each primer, 2.0 μl DNA, and 6.0 μl sterile water. The PCR included an initial enzyme-activation step at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C for 20 s and annealing at 55°C for 20 s; no extensions were used. The amplified PCR product was detected by electrophoresis using a 2% (wt/vol) agarose gel, stained in ethidium bromide for 10 min, and visualised under UV light on the transilluminator.

PCR for detection of fliC gene

E. coli O157 isolates were tested also for the presence of the fliC gene encoding the H7 bacterial flagellum antigen, using previously published primer sequences [343] (primer set C, Table 3.2). In addition, to ensure the DNA template used in this series of PCR assays was of bacterial origin, an internal control (E16S) was included (primer set C, Table 3.2). DNA amplification of the fliCH7 and bacterial 16S rRNA gene sequences was performed using the

automated real-time thermocycler. The final 20 μl PCR reaction mixture contained 2x PCR buffer (Taq PCR Mastermix, Qiagen), 5 μM of each primer for fliCH7, 10 μM of each primer

for bacterial 16S rRNA, 2.0 μl DNA, and 5.0 μl sterile water. The PCR included an initial enzyme-activation step at 95°C for 8 min, followed by 25 cycles of denaturation at 95°C for 10 s, annealing at 58°C for 10 s, and extension at 72°C for 10 s; the terminal extension was at 72°C for 7 min. Amplified PCR products were detected by electrophoresis using a 2% (wt/vol) agarose gel, stained in ethidium bromide for 10 min, and visualised under UV light on the transilluminator.

Concentration of E. coli in faecal samples

Pre-enriched broth samples were inoculated directly on selective culture media as described earlier under Enrichments and direct culture plating. Putative non-fermenting E. coli O157 and O26 colonies were counted on each culture plate to enumerate the concentration of viable E. coli in faecal samples prior to enrichment. If agglutination-positive E. coli isolates were identified in pre-enriched samples, the concentration of E. coli was calculated as log10 CFU/g

faecal material. If no E. coli isolates were identified due to concentrations below the detection limits of the selective culture media, the IMS method was used on the enriched samples as described above. If agglutination-positive E. coli isolates were identified in enriched samples by IMS, the concentration of E. coli was presented as a value below the detection limits of selective culture media of pre-enriched samples.

Of note, CT-RMAC culture media was not available at the start of the study and the direct inoculation of fresh faecal samples from 281 calves and 18 adult cattle could not be applied to enumerate the concentrations of presumptive E. coli O26 and STEC O26. However, 23 O26 isolates were retrieved with IMS from stored enrichments at a later stage in the study.