Invasive lung function measurements were performed by forced oscillation technique under mechanical ventilation, using FlexiVent equipment (SciReq, Montreal, Canada; purchased from EMMS, London, UK).
6.1. Measurement of airway hyperresponsiveness
Increasing MCh (Acethyl-β-Methyl-Choline Cholride, Sigma-Aldrich) concentrations (Table 3) in filtered PBS were administered to mechanically ventilated animals by means of an Aeroneb®Lab ultrasonic nebulizer (Aerogen, Galway, Ireland) coupled to the FlexiVent inspiratory line.
6.2. Preparation of animals for mechanical ventilation
Figure 15 depicts the setup for mouse mechanical ventilation and lung function testing.
6.2.1. Anaesthesia
Mice were weighed before sedation and this value was introduced into the FlexiVent software for automatic adjustment of total lung capacity (TLC) and tidal volume.
Figure 14. Adoptive tranfer of Treg cells. A group of mice received 28 i.n. instillations with HDM to stablish an experimental asthma model driven by primary HDM airway exposure in the absence of previous sensitization. An alternative HDM-instilled group was i.v.-injected with 7.5x104 GFP+ Treg cells on the day of instillation 24, to evaluate the immunoregulatory properties of these cells on established disease in vivo.
Table 3. MCh concentrations for airway reactivity testing.
Dose MCh concentration (mg/mL)
Average MCh dose per Kg body weight (mg/Kg)
D0 0 0
D1 1.25 1.56
D2 2.5 3.13
D3 5 6,25
D4 10 12.5
(D5)* 20 25
*: Dose D5 was administered in limited experiments where indicated.
For induction of anaesthesia, 2% sevoflurane was first administered into a plexiglass chamber as described for i.n. instillations, and then delivered through a nasal mask, leaving the neck of the mouse exposed. Deep anaesthesia was reached by increasing sevoflurane to 3%, and verified by the loss of the palpebral and toe-pinch reflexes.
6.2.2. Tracheostomy
The trachea was surgically exposed, and an incision between two upper-third tracheal rings was made to insert the cannula (FTC100 Tracheal Cannula, Ø 0.2 mm, EMMS). The cannula was then fixed with surgical silk to the trachea to avoid decannulation during animal manipulation.
6.2.3. Neuromuscular blockade and connection to the mechanical ventilator
A 0.15 mL volume of 0.5 mg/mL rocuronium (Esmeron®, Organon, Holland) was i.p. injected to abrogate spontaneous breathing. The animal was then quickly connected to the FlexiVent through the tracheal cannula and was kept anaesthetized by continuous sevoflurane inhalation through the ventilator inspiratory line. Ventilator settins used were 200-250 breaths/min respiratory rate, a tidal volume of approximately 0,14 mL (body weight-adjusted for each individual animal) and a PEEP of 2 cm H2O. Optimal settings for mouse mechanical ventilation are shown in Table 4.
The mouse mechanical ventilation module of the FlexiVent is provided with a piston (a) controlled by a high-precision linear motor (b).
The piston drives preset air volumes through the inspiratory arm (c) and to the tracheal cannula (d). Increasing MCh doses are administrated through an ultrasonic nebulizer (e). Expired air is drawn through the expiratory arrm, provided with a PEEP water trap (f), and then released through the exhaut. rat, guinea pig). The animals are usually connected to the ventilator through tracheostomy, such as the mouse shown inside the orange square. The panels at the bottom show the
Once the cannula is fixed, the animal is quickly connected to the ventilator.
Figure 15. Animal preparation for ventilatory mechanics.
Table 4. FlexiVent mouse ventilation parameters
Animal weight About 20 g
Displaced volume 0.18 mL
Tidal volume 0.12-0.14 mL
Tidal volume per weight 6.5-7 mL/Kg
Minute ventilation 25-30 mL/min
Respiratory rate 200-250/min
PEEP 2 cm H2O
Average inspiratory pressure 6-7 cm H2O Peak inspiratory pressure About 11 cmH2O
6.3. Measurement of pulmonary function variables
Pulmonary function variables were measured under mechanical ventilation by forced oscillation technique, using a single-compartment mathematical model as issued by the FlexiVent software (FlexiVent 5.2). For data collection, tidal-volume mechanical ventilation was transiently interrupted and pressure prime waves ("perturbations") were generated by the ventilator. Pulmonary resistance (RL), measured from 20-second "snap-shot" primewaves, was the primary variable analyzed, as an indicator of airway responsiveness to increasing MCh doses. Pulmonary elastance and the model's coefficient of determination were monitored to discard RL increases due to airway plugging, and for overall data quality. Once the anaesthetized animal was connected to the ventilator and the ventilation parameters adjusted as appropriate, tidal-volume ventilation was carried out until pulmonary function values were stable (this would usually take 1-2 minutes). Then a RL baseline value was averaged from a series of several prime waves. After RL baseline reading, the MCh nebulization protocol was performed starting with PBS and finishing with the maximum MCh concentration (see MCh concentrations on Table 3). For each nebulization, 25 μL of PBS or MCh solution was deposited into the nebulizer cup and passed through 20 seconds to the tidal volume-ventilated animal. After each nebulization was finished, prime waves and data collection were performed every 10 seconds for 3-4 minutes. A valid peak RL value was taken as the response RL to
each nebulization. The respective MCh doses were stepwise administered every 4 minutes until finishing the protocol. The airway responsiveness profile was presented as the curve generated from the successive peak RL values obtained after the corresponding MCh doses. Airway hyperresponsiveness was considered when RL was significantly higher than baseline RL at 10 mg/mL MCh or earlier, and significantly higher than control RL for the same MCh dose.
To avoid artifact data due to the formation of atelectases during mechanical ventilation, a total lung capacity (TLC) manoeuvre or “sigh” was administered as necessary. During this manoeuvre, the ventilator distends the lungs up to a 300 mmH2O pressure, which usually uncollapses the lung parenchyma and/or plugged airways (597).
7. Euthanasia and specimen collection procedures 7.1. Euthanasia
Once the lung function data collection protocol was completed, a bolus of 0.2 mL heparin (Sodium heparin 1000 IU/mL, MAYNE PHARMA S.L., Madrid, Spain) was i.v. injected to avoid post-mortem blood clotting. Then, 0.3 to 0.5 mL of potassium chloride (14.9% w/v, BRAUN, Melsungen, Germany) was i.v. administered in the tail to induce cardiac arrest in the deeply anaesthetized animal.
7.2. Bronchoalveolar lavage
BAL was collected for total and differential leukocyte counts, and to store samples of its fluid fraction for further analysis. For this purpose, 1 mL of PBS was introduced into the lungs using a syringe connected to the tracheal cannula. The PBS was then slowly retrieved, which allowed for a approximate 0.7 mL fluid recovery. This BAL fraction was introduced in a conic polypropylene tube (Falcon) and plunged on ice until processing. A second BAL fraction was obtained using a three-way stopcock (Discofix® C, Braun) connected to the tracheal cannula, a PBS-filled syringe, and a collection syringe. Four mL of PBS was introduced into the lungs in 1-mL steps, and each mL was sequentially recovered and pooled into a clean centrifuge tube. The first BAL fraction was centrifuged at 458⋅g for 5 minutes, and its supernatant aliquoted into 2-mL low protein adherence tubes (Protein LoBind, Eppendorf Ibérica, Madrid, Spain) and stored at -80 ºC. The cell pellet was resuspended and pooled into the second BAL fraction, which was then centrifuged. The supernatant was discarded and the cell pellet, comprising the total cells from the first and second BAL fractions, was resuspended in 1 mL of PBS. From this suspension, total cell counts were done under the microscope using a Neubauer chamber (ZUZI Corp., France), and cell viability was checked by tripan blue dye (Gibco, Invitrogen) exclusion. Cell concentration was then adjusted to 400,000
viable cells per mL, and cytocentrifuged specimens containing 60,000 cells were prepared for differential leukocyte counts as follows: 150 μL of the adjusted cell suspension was placed into each of several cytocentrifuge cones (Universal 32, Hettich, Tuttlingen, Germany) mounted on adherent microscope slides (SuperFrost® Plus, Menzel-Gläser, Braunschweig, Germany), and centrifuged at 28⋅g for 6 minutes in the proprietary "cytospin"centrifuge. The slides were then allowed to dry at room temperature for 20 minutes, and were fixed in methanol (Panreac, Barcelona, Spain) for 10 minutes. After fixation, the slides were again dried at room temperature for 20 minutes, and stored at -20ºC for later staining.
7.3. Lungs
A mid-sagittal incision was done in the abdomen through the skin, subcutaneous tissue, muscular plane, and parietal peritoneum, using a scalpel. Once the abdominal cavity was exposed, the bowels were separated to expose the inferior vena cava and abdominal aorta on the posterior abdominal wall. Then, the diaphragm muscle was cut using blunt scissors, taking care to not damage the lungs. After pulmonary collapse by diaphragmatic incision, the chest was opened through a mid-sternal line up to the neck tracheotomy. The abdominal cava-aorta bundle was cut and the right ventricle was punctured with a syringe and needle to perfuse the pulmonary vascular circuit with PBS before lung extraction. After perfusion, the lungs were excised in bloc from the thoracic cavity, along with the cannulated tracheobronchial tree and heart. The lungs were then inflated at 25 cmH2O standardized pressure by connecting the tracheal cannula to a recirculation pump with 4% formaldehyde (Panreac) in PBS for 20 hours, for normalized quantitative morphology. After fixation, lung sagittal slices were introduced into histological casettes, immersed in 70% ethanol (Panreac) and placed into a carousel tissue processor (STP 120 Spin Tissue Processor, Thermo Scientific, Madrid, Spain) overnight, with a paraffin inclusion program detailed on Table 5. Once processed, the specimens were blocked in paraffin and cut with a microtome (RM2155, Leica Microsystems, Wetzlar, Germany). Four-μm tissue sections were laid onto adherent microscopy slides (SuperFrost® Plus, Menzel-Gläser) for subsequent staining procedures.
Table 5. Tissue processor program.
Station Reactive Time Agitation (0/1/2)
1 Ethanol 70º - 0
2 Ethanol 70º 1h 1
3 Ethanol 96º 1h 30min 1
4 Ethanol 96º 1h 30min 1
5 Ethanol 100º 1h 1
6 Ethanol 100º 1h 30min 1
7 Ethanol 100º 1h 30min 1
8 Xylene 1h 1
9 Xylene 1h 1
10 Xylene 1h 1
11 Paraffin 3h 1
12 Paraffin 3h 1
7.4. Skulls
Heads were sectioned at cerebellomedullary cistern level to separate the skull from the spine, and the skin, eyes, brain and lower jaw were excised. The skulls were immersed in formalin and the air contained in the nose was purged by introducing formalin through the epipharynx with a blunt needle. This procedure eliminated the air trapped in the upper airway to ensure correct fixation of the nasal cavity structures (266). The skulls were fixed for 20 hours and then immersed into a decalcifying solution (SHANDON TBD-1TM, Thermo Fisher Scientific) for 5 hours. After decalcification, frontal slices of the nasal cavity were cut with a scalpel in standardized anatomic locations, according to the Young protocol established in rats (266) and later adapted for mice by Farraj et al. (263). We processed the samples as per Farraj with minor modifications. A proximal cut was done behind the incisisor teeth, middle cut at the first palatal ridge, and distal cut at the 3rd palatal ridge (Figure 16).
8. Histological staining and specific detection procedures
Specimens were submitted to a variety of histological stains, immunohistochemistry and nucleic acid hybridization procedures for analysis (figrures 17 and 18). Wright-Giemsa staining was done for leucocyte differential counts on BAL cytocentrifuged slides. For general histopathological assessment, and to identify eosinophils in inflammatory infiltrates in the lungs or nasal sections, haematoxylin-eosine staining (H-E) was employed. To identify mucus-producing cells in the airways, such as goblet cells, periodic acid-Schiff (PAS) stain was used. Masson trichrome stain was performed for the analysis of extracellular matrix deposition. Contractile airway tissue was detected by immunohistochemistry using an antibody to alpha smooth muscle actin (α-SMA). In adoptive transfer experiments, GFP-expressing cells were localized in the tissues by immunohistochemical GFP detection. Where appropriate, in situ hybridization was performed to identify Foxp3, Il10, and Tgfb mRNAs in lung cells.
8.1. Wright-Giemsa
This technique, first described by Romanowsky in 1902, is broadly used to stain cell smears . It is based on eosin and azure colorant-releasing derivates (azure A, B and methylene azure). Eosin acts as an anionic cytoplasmatic colorant, staining extracellular components and certain acidophil structures, while azure cationic derivates stain basophilic structures, like chromatin.
Cytocentrifuged BAL samples were retrieved from -20ºC storage, defrosted at room temperature for 30 minutes and introduced into acid alcohol (37% hydrochloric acid in 96º ethanol, Panreac). They were then stained with Wright solution (Gurr®, VWR, Barcelona, Spain) for 10
Figure 16. Nasal cavity in mouse. We analyzed the nose tissues at three frontal sections: proximal at incisisor teeth level, middle at first palatal ridge, and distal at third palatal ridge.
minutes and washed with distilled water until a change in color was appreciated. After filtration to discard precipitates, the samples were stained with commercial Giemsa solution (Merck) for 30 minutes, and then differentiated into glacial acetic acid (Panreac) to get a regular colored tone.
Finally, the samples were passed through 96º ethanol (taking care to not to decolor them excessively), 100º ethanol and xylene (Panreac), and were mounted with DePex mounting medium (Gurr®, VWR)
Figure 17. Especimen collection and analysis procedures. Lung function was evaluated using FelxiVent ventilator and then BAL was collected for total and/or differential cell counts. Upper and lower airways were collected, formaldehyde fixed and paraffine embebeded. Haematoxylin-eosin (H-E), PAS, Masson thricrome, α-actin immunohistochemistry (IHC), FISH and/or GFP+ IHC were performed as required.
LUNG FUNCTION (FlexiVent)
− Histopathology assesment (H-E)
− Mucous substances (PAS)
− Subepithelial fibrosis (Masson)
− MCT (α-actin IHC)
− mRNA expression (FISH)
− GFP+ cell detection (GFP IHC) Total/differential cell count in BAL (Wright-Giemsa)
8.2. Haematoxylin-eosin
Haematoxylin is a vegetable colorant, extracted from the heartwood of the logwood tree (Haematoxylum campechianum). When oxidized, haematoxylin acquires a dark purple color. It is basic or cationic and therefore is used to stain acidic cellular components, like the nucleus.
Haematoxylin has a limited capacity to remain in the tissues and must be combined with metallic ions (iron salts or aluminum) that act as mordant. Eosin is an acidic fluorescein derivative that gives a dark pink color and is used to stain basic cellular components, mostly present in the cytoplasm.
Four-μm tissue sections were deparaffined by placing them into a heater at 60ºC for 30 minutes and immediately immersing them in xylene baths until all paraffin was removed. The samples were then rehydrated through 100º ethanol, 96º ethanol, distilled water and tap water with 1 ‰ HCl (Merck); the iron contained in tap water favours haematoxylin fixation to the tissues. After rehydration, the samples were immersed into Harrys’ Haematoxylin (Panreac) for 5 minutes and then washed several times in tap water to attenuate the excess colorant. The samples were then immersed into an eosin solution (see appendix) for 5 minutes and then dehydrated in 96º, 100º ethanol and xylene, and mounted with DePex mounting medium.
Figure 18. Histological staining techniques. We used several staining techniques to analyze histological samples derived from the animals of the study. This figure shows histological sections stained using haematoxylin-eosin (A), periodic acid Schiff (B), Masson thricrome (C), immunofluorescence for a-sma (D) and GFP (E) and in situ hybridization for Foxp3 (F), Tgfb, and Il10 mRNA. Scale bars: A, B, and C 50 µm; D, 100 µm; E, 10 µm; and F, 25 µm.
8.3. Periodic acid-Schiff (PAS)
Mucopolysaccharides are the main mucus components and are substances rich in hexoses and acetylated or sulfonated acids. The PAS staining technique is based on its ability to break the links of the hexose ring and expose aldehyde groups, which are then bound by the Schiff reactive. This reactive is a fuchsine derivate that produces leuco-sulfonic acid, a colorless unstable compound, that becomes purple-violet when it binds the aldehyde groups and loses its sulphuric acid. Thus, PAS-positive substances stain from intense pink to violet.
Four-μm tissue sections were deparaffined and rehydrated as described, except for the use of tap water. The samples were then immersed in periodic acid solution (see appendix) for 10 minutes, washed in tap water, and placed in Schiff reactive (Merck) in the dark for 30 minutes. After that, the slides were immersed in sodium bisulfite (Sigma-Aldrich) for 10 minutes, and washed with tap water again. The sections were then placed in Harrys’ haematoxylin for 10 minutes and washed in tap water. Finally, the samples were dehydrated and mounted with DePex.
8.4. Masson’s trichrome
Collagen fibers are the most abundant component of conjunctive tissues and are derived from procollagen secretion by several cell types, such as fibroblasts. The main function of collagen is to provide resistance and physical support to tissue structures. There are several types of collagen, being I and IV the types mostly found in subepithelial fibrosis and those detected by Masson's trichrome staining. This staining technique is based on the use of acid fuchsine to stain conjunctive tissue and Weigert’s ferric haematoxylin to stain the cell nuclei.
Four-μm tissue sections were deparaffined and rehydrated as described, ending in tap water . The slides were then immersed in ferric aluminum aqueous solution (Merck) for 20 minutes (ferric alum acts as a mordant, favoring subsequent haematoxylin staining), and salt debris was then removed by washing the slides in tap water. The samples were then stained with Weigert’s ferric haematoxylin (Sigma-Aldrich) for 10 minutes and washed again in tap water until getting a dark-grey tissue color. Next step was incubation in picric acid (Panreac) for about 6 minutes (time varied depending on reactive maturation), to favor acidy for subsequent staining with fuchsine. After incubation, the slides were washed in tap water until they became yellow, a color shift attributed to the picric acid. The samples were then immersed in Ponceau’s fuchsine (Certistain®, Merck) for 8 minutes and washed twice with 1% phosphomolybdic acid (Merck) solution in distilled water for 5 minutes. Collagen was then stained with with aniline blue (Merck) for 12 minutes. The slides were finally washed several times in distilled water, dehydrated through 96º and 100º ethanol and xylene, and mounted in DePex.
8.5. Alpha-smooth muscle actin immunohistochemistry
Alpha-SMA is the predominant actin isoform in the contractile apparatus of smooth muscle cells, and is also present in myofibroblasts.
Four-μm tissue sections, deparaffined and rehydrated, were subjected to cell membrane permeabilization with 0.2 % Triton X-100 (Sigma-Aldrich) in PBS for 20 minutes and then blocked with a universal blocking solution (Image-iTTM Signal Enhancer; Molecular Probes, Invitrogen) for 30 minutes with the aim of reducing tissue autofluorescence. Mouse anti-α-SMA IgG2a monoclonal antibody (clone 1A4, Sigma-Aldrich) was used as primary antibody (1:100 dilution), followed by Alexa Fluor® 488 labeling kit (Molecular Probes, Invitrogen) as detection system as per manufacturer’s instructions, in PBS with 20% goat serum (Vector Labs, Peterborough, UK) and 0,1% Tween-20 (Sigma-Aldrich) as diluent. Nuclear counterstaining was done with DAPI (SelectFXTM Nuclear Labeling Kit, Molecular Probes, Invitrogen). The stained specimens were then fixed in 4% paraformaldehyde (Sigma-Aldrich) to favor longer Alexa fluorochrome stability, and mounted a permanent medium optimized for fluorescence microscopy (ProLong® Gold, antifade reagent; Molecular Probes, Invitrogen).
8.6. Green fluorescent protein immunohistochemistry
The native fluorescent signal of GFP and its variants, although appropriate for flow cytometry, is usually not reliably detectable in fixed tissue sections. Indirect GFP detection by immunohistochemistry allows to overcome this limitation and provides a highly specific, amplified signal.
Four-μm lung sections were deparaffined, rehydrated and permeabilized as described, blocked with Mouse-on-Mouse blocking reagent (Vector Labs), and incubated with mouse anti-GFP monoclonal antibody JL-8 (Clontech). The primary antibody was followed by a biotinylated horse anti-mouse secondary antibody, an avidin-biotin-alkaline phosphatase complex, and development with Vector Red chromogen (all from Vector Labs). Cell nuclei were counterstained with methyl green solution (Sigma-Aldrich; see appendix for recipe). The specimens were then dehydrated and mounted in DePex.
8.7. Fluorescence In-situ hybridization (FISH)
The FISH thecnique employs labeled DNA or RNA strands, complementary to a specific DNA or RNA squence to be localized in tissue sections. In this work, FISH was performed on lung sections using digoxigenin or biotin-labeled DNA probes, followed by fluorescently labeled antibodies to detect the hybridized probes.
Table 6. Probes for FISH
Probe Name Sequence (5’ – 3’)
11 polyT TTTTTTTTTTTTTTTTTTTTTTTTT
12 Foxp3 positive2 CATAGCTCCCAGCTTCTCCTTTTCCAGCTCCAGCT 13 TGFB positive1 TCATGTTGGACAACTGCTCCACCTTGGGCTTGCGA 14 TGFB positive2 ATTCCGTCTCCTTGGTTCAGCCACTGCCGTACAAC 15 TGFB positive 3 GCTTCCGTTTCACCAGCTCCATGTCGATGGTCTTG 16 IL10 positive 2 TTGATTTCTGGGCCATGCTTCTCTGCCTGGGGCAT 17 IL10 positive3 TCTGGCCGACTGGGAAGTGGGTGCAGTTATTGTCT 18 Foxp3 negative1 accacaatatgcgaccccctttcacctatgccacc
19 Foxp3 negative2 agctggagctggaaaaggagaagctgggagctatg 20 Foxp3 negative3 gaggagccagaagagtttctcaagcactgccaagc 21 TGFB negative1 tcgcaagcccaaggtggagcagttgtccaacatga 22 TGFB negative2 gttgtacggcagtggctgaaccaaggagacggaat 23 TGFB negative 3 caagaccatcgacatggagctggtgaaacggaagc 24 IL10 negative 1 cccctgtgaaaataagagcaaggcagtggagcagg 25 IL10 negative 2 atgccccaggcagagaagcatggcccagaaatcaa 26 IL10 negative3 agacaataactgcacccacttcccagtcggccaga
8.7.1. In-situ hybridization design
Thirty-five-nucleotide probes against Foxp3, Tgfb and Il10 mRNA sequences were designed aiming at the same melting temperature (Tm) and GC content. Once the theoretical probes sequences were generated using National Center for Biotechnology Information resources (available on-line at www.ncbi.nlm.nih.gov) and TIB mol resources (available on-line at www.tib-molbiol.com), potential intra-probe dimer and hairpin formation, as well as heterodimer formation between probes, were checked using Primer3web software (598). No other mRNA homologues were found in mouse or rat using a Basic Local Alignment Search Tool (BLAST software, provided
online by the National Institutes of Health, USA). One, two and three probes, complementary to different sequences, were tested for Foxp3, Il10, and Tgfb mRNAs (Table 6, probes 12 – 17),
online by the National Institutes of Health, USA). One, two and three probes, complementary to different sequences, were tested for Foxp3, Il10, and Tgfb mRNAs (Table 6, probes 12 – 17),