• No results found

2. Materials and Methods 62-

2.7 Manipulation of recombinant DNA

2.7.1 Primer design.

Oligonucleotides were purchased from MWG Biotech, NC, USA. The p37 open reading frame (ORF) was obtained from the ORE of pp220 (CP2475L), from the African swine feyer yirus BA71y genome using the following primers: forward GGATCCTGCTGCTCTCACAGTTGAAG (genome co-ordinates (bold) 106338- 106320) and reyerse GAATTCCTTACTCAGGTTCTAGCTCATCGG (genome co-ordinates (bold) 105250-105223). The p34 ORF was obtained from the CP2475L gene of the BA71y strain of ASFV using the following primers: forward

GGATGGGGGGGACAAAAATCCTGTACAAC (genome co-ordinates (bold)

107772-107751) and reyerse GAA7TGGTTATAGTGGCGTTTTCTCCTCGTC (genome co-ordinates (bold) 106780-106801). The primers were also designed to incorporate Bam HI and EcoRI restriction sites (italics) when used in a polymerase chain reaction (PCR).

2.7.2 Polymerase chain reaction (PCR).

5|il 10X Taq buffer 4|llI MgCl2

2|liI 5mM dNTP

2111 10OjiM forward primer 2pl lOOjiM reverse primer

100ng DNA template 5U Taq polymerase

To 50|xl with sterile double distilled water.

The reaction mixture was overlaid with SOpI mineral oil and placed in a Biometra Trio thermoblock. The following PCR cycling parameters were used: Denature 94°C for 30 sec

Denature 94°C for 30 sec ^

Anneal 55°C for 30 sec ► 30 cycles

Polymerise 72°C for 30sec ,

Polymerise 72°G for 10 minutes

10|il aliquots of each reaction were run on a 0.7%(w/v) agarose gel and the bands were visualised by ethidium bromide staining. The PCR product was isolated using the Qiagen Qiaex II kit (Qiagen Ltd, UK) (see below).

2.7.3 Restriction digestion of DNA.

Endonuclease digestions were performed according to the manufacturers instructions, normally performed in a 37°C waterbath.

2.7.4 Purification of DNA fragments.

DNA fragments were purified by running the samples on a 1% agarose gel, containing 0.1% ethidium bromide. The DNA bands were excised from the gel and the DNA was purified from the agarose using the Qiagen Qiaex II kit. The excised DNA/agarose was placed in a sterile 1.5ml microfuge tube and three volumes of QX1 buffer was added, along with SOpI Qiaex II beads to bind the DNA. The sample was incubated at >50°C for 10 minutes to melt the agarose. The sample was centrifuged for 30 seconds at 16,000g and the pellet was washed once in 500|liI QXI buffer, followed by two washes in 500|liI wash buffer.

The pellet was air-dried, resuspended in 20jil distilled water and incubated at 50°C for 5 minutes to elute the DNA. The beads were pelleted at 16,000gf for 30 seconds and the purified DNA was removed to a sterile tube.

2.7.5 Ligation of DNA.

Ligations were performed at 16°C overnight. Each lOpI reaction consisted of 50-1 OOng of linearised vector, 0.5-1 pg PCR product or DNA insert, Ijil 10X ligation buffer, 1-3U T4 DNA ligase (Promega) and distilled water to the final volume.

2.7.6 Transformation of bacteria.

50jil of JM109 competent cells (Promega) was thawed on ice. 1-1 Opl (1- lOng) of plasmid DNA or ligation reaction was added to each tube, mixed gently, and placed on ice for 1 hour. The DNA/competent cell mix was heat shocked for 40 seconds at 42°C and placed on ice for 2 minutes. lOOpI LB broth was added

was plated out onto agar plates containing the appropriate antibiotic and incubated overnight at 37°C.

2.7.7 Preparation of plasmid DNA.

2.7.7.1 Minipreps.

Single colonies were picked from the agar plates and added to 5ml of LB broth, containing antibiotic, in a 20ml Universal tube. The tubes were incubated overnight in a 37°C orbital shaker at 2,000rpm. 1.5ml of culture was removed and the bacteria were pelleted for 2 minutes at 16,000g. The pellets were resuspended in lOOpI of suspension buffer and placed on ice for 5 minutes, 200pl lysis buffer was added and the suspension was mixed by inverting the tubes 3-4 times and then incubated on ice for 5 minutes. ISOpI sodium acetate buffer was added, the solution was mixed by inverting, and placed on ice for a further 5

minutes. The suspension was centrifuged for 5 minutes at 16,000g. The

supernatant was carefully decanted onto 450pl phenol/chloroform solution and mixed by vortexing. The mixture was centrifuged for a further 5 minutes at 16,000g and the top layer was pipetted off, added to 1ml of ice-cold absolute ethanol and incubated at -20°C for 30 minutes. The DNA was pelleted by centrifugation at 16,000g for 15 minutes at 4°C. The pellet was washed in 70% ethanol and dried. The pellet was resuspended in 30|il of sterile double distilled water.

2.7.7.2 Maxiprep.

300ml LB broth, containing antibiotic, and placed in a 37°C orbital shaker overnight. The bacterial cells were harvested at 6000g for 15 minutes at 4°C and resuspended in 10ml PI suspension buffer. 10ml P2 lysis buffer was added and the suspension was mixed by inverting several times and then incubated at RT for 5 minutes. 10ml of chilled P3 precipitation buffer was added, mixed and incubated on ice for 20 minutes. The lysates were centrifuged at 20,000g for 30 minutes at 4°C and the supernatant was filtered with a p re wetted Millipore glass fibre prefilter. The supernatant was added to an equilibrated Qiagen-tip 500 column and allowed to pass through the resin by gravity flow. The Qiagen-tip was washed twice with Qiagen wash buffer and the DNA was eluted with 15ml QF elution buffer. The DNA was precipitated with isopropanol and immediately centrifuged for 20 minutes at 15,000g at 4°C. The pellet was washed in 70% ethanol, air-dried at RT and resuspended in 300[i\ sterile double distilled water.

Related documents