Materials and Methods

Construct Design. The DNA templates for the transcription of HbLtRNA and MjYtRNA included a 500 nucleotide overhang at the 5’-end (for improved stability of the DNA template against degradation and improved PCR yields [23]), a T7 RNAP promoter, hammerhead ribozyme and suppressor tRNA. The templates were constructed by sequential PCRs [47] using a forward primer and multiple reverse primers. The final constructs were PCR-amplified using a forward primer and a reverse primer, which was modified by 2’-O-methylation. All primers were ordered from IDT (Integrated DNA Technologies) and are listed in Table 1. In case of

ScQtRNA, the DNA construct included the T7 RNAP promoter immediately prior to the tRNA sequence with no hammerhead sequence in between, as the ScQtRNA sequence starts with GG at the 5’ end. The sequences of all tRNAs are listed in Table 2. For long-time storage, all three constructs for HbLtRNA, MjYtRNA and ScQtRNA were cloned into the T7 expression vector pETMCSI [48] between the NdeI and EcoRI sites using RQ-SLIC [49].

An expression system for Methanobacterium thermoautotrophicum leucyl-tRNA synthetase (MtLRS) was constructed from the gene synthesized by IDT with codon optimization for expression in E. coli. The gene was cloned into the T7 expression vector pETMCSI [48] between the NdeI and EcoRI sites using the RQ-SLIC protocol [49]. The protein contained a N-terminal His6-tag followed by a TEV cleavage site. In this as in all other cloning projects, the E. coli strain DH10B was used and the DNA sequence of the final plasmid was confirmed by Sanger sequencing. The plasmid was transformed into E. coli

BL21(DE3)pLysS cells for overexpression.

Table 1. Nucleotide sequences of primers used for construction of the DNA template for

HbLtRNA and MjYtRNA transcription.a Primers

92 Name Sequence HbLtRNA-Fb _{5’ - TTCCGAATACCGCAAGCGACAG} HbLtRNA-R1 5’ - TAGAGTCCGTCGCCGTTGGCCGAGCTTGGCTACCCTGGGGACGGTACCGGGTACCGTTTC HbLtRNA-R2 5’ - TCGAACTCCTACGAGAACGGATTTAGAGTCCGTCGCCGTTGGC HbLtRNA-R3 5’ - TGGTCCCAGGGAAGGGATTCGAACCCTCGAACTCCTACGAGAACGGATTTAG HbLtRNA-R4 5’ - mUmGGTCCCAGGGAAGGGATTCGAACCC MjYtRNA-R1 5’ - TTTAGAGTCCGCCGTTCTGCCCTGCTGAACTACCGCCGGGACGGTACCGGGTACCGTTTC MjYtRNA-R2 5’ - TGGTCCGGCGGAGGGGATTTGAACCCCTGCCATGCGGATTTAGAGTCCGCCGTTCTGCCC MjYtRNA-R3 5’ - mUmGGTCCGGCGGAGGGGATTTG

a _{The reverse primers listed were used in sequential PCRs to create the final DNA template.} The letter ‘m’ in the sequences identifies 2’-O-methyl-modification of the following nucleotide. Underlined nucleotides represent overhang sequences.

b _{The sequence of MjYtRNA-F is same as HbLtRNA-F}

Table 2. tRNA sequences of HbLtRNA, ScQtRNA and MjYtRNA. tRNA sequences HbLtRNA (88) 5’-CCCAGGGTAGCCAAGCTCGGCCAACGGCGACGGACTCTAAATCCGT TCTCGTAGGAGTTCGAGGGTTCGAATCCCTTCCCTGGGACCA-3’ ScQtRNA (75) 5’-GGTCCTATAGTGTAGTGGTTATCACTTTCGGTTCTAATCCGAACAAC CCCAGTTCGAATCCGGGTGGGACCTCCA-3’ MjYtRNA (77) 5’-CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCAT GGCAGGGGTTCAAATCCCCTCCGCCGGACCA-3’

Table 3. Sequence of complete tRNA constructsa_.

HbLtRNAa _{TTCCGAATACCGCAAGCGACAGGCCGATCATCGTCGCGCTCCAGCGAAAGCGGTCC} TCGCCGAAAATGACCCAGAGCGCTGCCGGCACCTGTCCTACGAGTTGCATGATAAA GAAGACAGTCATAAGTGCGGCGACGATAGTCATGCCCCGCGCCCACCGGAAGGAG CTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGACGCTCTCCCTTATGCGACTC CTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCCGCA AGGAATGGTGCATGCAAGGAGATGGCGCCCAACAGTCCCCCGGCCACGGGGCCTG CCACCATACCCACGCCGAAACAAGCGCTCATGAGCCCGAAGTGGCGAGCCCGATC TTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGG TGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCGAGATCTCGATCCCGCGAAAT TAATACGACTCACTATAGGGAGACCGGCTGATGAGTCCGTGAGGACGAAACGGTA CCCGGTACCGTCCCCAGGGTAGCCAAGCTCGGCCAACGGCGACGGACTCTAAATCCG TTCTCGTAGGAGTTCGAGGGTTCGAATCCCTTCCCTGGGACCA ScQtRNAb _{CACCATATGGAAAACCTGTATTTTCAGGGCGAGGATCGAGATCTCGATCCCGCGAAA} TGGCGTAATACGACTCACTATAGGGTCCTATAGTGTAGTGGTTATCACTTTCGGTTCT

93

AATCCGAACAACCCCAGTTCGAATCCGGGTGGGACCTCCA

a _{T7 RNAP promoter (in bold) is followed by hammer head ribozyme sequence (underlined)} and HbLtRNA sequence (bold and italic). The same construct was used for MjYtRNA. b _{T7 RNAP promoter (underlined) is followed immediately with ScQtRNA sequence (bold and} italic).

Protein expression and purification. T7 RNAP (P266L mutant) was purified as described previously [50]. Briefly, the protein expression was induced by 0.5 mM isopropyl-b-D-1- thiogalactopyranoside (IPTG) at OD600 = 0.8–1 for 2 L LB medium containing 100 mg/L ampicillin. After 3 h of incubation at 37 o_{C, cells were harvested and lysed by French press in} buffer A (50 mM Tris-HCl pH 8.1, 400 mM NaCl, 20 mM imidazole, 5 mM 2- mercaptoethanol) with one tablet of cOmplete EDTA-free protease inhibitor (Roche). The supernatant was loaded onto a 5 mL Ni-NTA column and eluted by a gradient of up to 100% buffer B (50 mM Tris-HCl pH 8.1, 400 mM NaCl, 300 mM imidazole, 5 mM 2- mercaptoethanol) over 100 mL. The fractions containing T7 RNAP were identified by 12% SDS-PAGE, concentrated with an Amicon Ultra-15 centrifugal filter unit with Ultracel-10 membrane (Merck Millipore) to 4 mL and loaded onto the gel filtration column (200 Superdex 26/60). Buffer C (20 mM sodium phosphate pH 7.7, 150 mM NaCl, 1 mM EDTA, 5 mM DTT) was used to elute the protein. The final protein-containing solution was stored in 60% glycerol and 10 mM DTT at a final concentration of 2.4 mg/mL.

In case of MtLRS, cells were grown at 37 °C in LB medium (10 g/L tryptone, 5 g/L yeast extract and 5 g/L NaCl) containing 100 mg/L ampicillin and 34 mg/L chloramphenicol. Following cell growth to OD600 = 0.8–1.0, IPTG was added to a final concentration of 1 mM to induce protein expression. After induction, the cells were incubated overnight at room temperature. The cell culture was centrifuged at 5,000 g for 15 minutes at 4 °C and the cells were lysed in lysis buffer (10% glycerol, 1 mM PMSF, 2 mM 2-mercaptoethanol, 300 mM NaCl, 50 mM HEPES-KOH, pH 7.5) using sonication. The supernatant was applied to a 5 mL Ni-NTA column (GE Healthcare) and bound protein was eluted with a gradient of 10–500 mM imidazole in 300 mM NaCl and 50 mM HEPES-KOH, pH 7.5. TEV protease (MHT238D) [51] was added to purified protein and the mixture was dialysed overnight at 4 °C against 50 mM Tris-HCl, 300 mM NaCl and 1 mM 2-mercaptoethanol. The cleavage yield was about two thirds as estimated from SDS-PAGE. The mixture was loaded onto a 5 mL Ni-NTA column to separate the final product from the His7-tagged TEV protease. The final protein was buffer

94 exchanged into storage buffer (50 mM HEPES-KOH pH 7.5, 150 mM NaCl, 1 mM DTT and 10% glycerol) and stored at -20 °C.

Expression and purification of EF-Tu with either N-terminal or C-terminal His6-tag was carried out as described earlier [35].

tRNA transcription. In vitro tRNA transcription was carried out as described earlier [24]. The tRNA was transcribed directly from a PCR-amplified DNA fragment. Transcription was performed under conditions optimized for the T7 RNAP prepared in-house: 40 mM Tris-HCl (pH 8.1), 1 mM spermidine, 12 mM MgCl2, 4 mM of each NTP, 5 mM dithiothreitol (DTT), > 40 ng/µl DNA template or 2% (v/v) of the PCR mixture and 0.033 mg/mL T7 RNA polymerase. The reaction was incubated for 5 h and the temperature increased to 75 o_{C for 20} minutes in order to deactivate the enzyme. The reaction was further incubated at 60 o_{C for 1 h} to enhance autocatalytic excision of the ribozyme.

Transcribed tRNA was purified using phenol/chloroform extraction. An equal volume of Tris-HCl saturated phenol and chloroform was added to the reaction mixture in a 1.7 mL microcentrifuge tube and mixed by vortexing. The phases were separated by centrifugation at high speed for 30 minutes. The aqueous phase was transferred to a new 1.7 mL microcentrifuge tube and 2-3 volumes of 100% ethanol were added. The tube was kept at either -80 o_{C for 30} min or -20 o_{C for 2 h and centrifuged at high speed for 30 minutes to precipitate the tRNA. The} pellet was washed twice with 70% ethanol and dried under vacuum for 30 minutes. Finally, the dried pellet was dissolved in 0.5 mL autoclaved nuclease-free water (Promega, USA) with 12 mM MgCl2 and the concentration was calculated from absorbance measurements at 260 nm using a Nanodrop spectrophotometer (Thermofisher, USA).

Total tRNA extraction. Total tRNA was prepared from E. coli BL21(DE3) cells grown in 1 L LB medium. The cells harboured the pBSTNAV plasmid [52] for transcription of tRNA under the lpp promoter and rrnC terminator. pBSTNAV was a gift from Luc Ponchon (Addgene plasmid # 45801). Purification of total tRNAs was carried out as described earlier [53] with some modifications. Briefly, cells were harvested after 24 h and dissolved in 10 mL 0.3 M potassium acetate pH 4.8. To the solution in a 50 mL tube, 10 mL of water saturated phenol were added. The tube was shaken for 1 h at room temperature, followed by centrifugation and collection of the aqueous layer. 30 mL of 100% ethanol was added and the tube was stored at -20 o_{C overnight. The following day, the tube was centrifuged at 18,000 rpm}

95 for 30 minutes at 4 o_{C. The pellet was dissolved in buffer A (20 mM Tris-HCl pH 7.5, 10 mM} MgCl2, 0.2 M NaCl), loaded onto a Q-sepharose column and eluted with buffer B (20 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 M NaCl). The eluate was ethanol-precipitated twice and rinsed with 70% ethanol. The final pellet was dissolved in water and the tRNA concentration determined by UV absorption.

Acid-urea PAGE. Denaturing polyacrylamide gel electrophoresis (acid-urea PAGE) was carried out on a 0.4 mm ´ 20 cm ´ 45 cm gel. To prepare the gel, 6.5% polyacrylamide (19:1 acrylamide/bisacrylamide), 0.1 M sodium acetate pH 5 and 8 M urea were dissolved under stirring (without heating the solution), and TEMED (0.15% v/v) and ammonium persulfate (0.7% w/v) were added before casting the gel. The gel was allowed to polymerize for approximately 2 h. A short pre-electrophoresis (∼30-50 minutes) was performed prior to loading the samples. The electrophoresis buffer was 0.1 M sodium acetate pH 5. Electrophoresis was carried out in the cold room at 500 V (∼12 V/cm) for 18−24 h until the bromophenol blue dye reached the bottom of the gel. The preparation of sample buffer and other running procedures were performed as described elsewhere [38, 54].

Aminoacylation. Aminoacylation was carried out at 37 °C in a 1-5 mL reaction containing 10 µM suppressor tRNA, 1 µM synthetase, 100 mM HEPES-KOH pH 7.5, 10 mM KCl, 20 mM MgCl2, 1 mM DTT, 10 mM ATP and 100 µM 15N/13C-labelled amino acid. The aminoacylation reaction mixture was purified using phenol/chloroform extraction as described above and the dried pellet was directly dissolved in the master mix buffer of the cell-free protein synthesis reaction.

Malachite green assay. To measure the aminoacylation efficiency, a spectrophotometric assay based on the complex between malachite green, molybdate and orthophosphate was performed, in which colour formation was measured at 600–660 nm with a plate reader. The malachite green phosphatase assay kit for the detection and quantification of phosphate was purchased from Echelon Biosciences (USA). The aminoacylation reactions were stopped by the addition of 100 µl malachite green and developed for 30 minutes at room temperature. Absorbances were measured at 620-600 nm using a SpectraMax M2 spectrophotometer equipped with a plate reader (Molecular Devices, USA)

96 Gel shift assay. Electrophoretic mobility shift assays (EMSA) for detecting protein-nucleic acid interactions were carried out using a 0.7-1.2% Tris-acetate EDTA (TAE)-agarose gel for 30-90 minutes at 110 V [55].

S30 extract preparation. S30 extracts were prepared following the protocol by Apponyi et al. [56] from 20 L cultures of E. coli BL21(DE3)::RF1-CDB3. Following production of the S30 extract, the termination factor RF1-CBD3 was removed from the S30 extract by filtration through a gravity-flow chitin column (20 mL chitin beads, New England Biolabs) [46]. S30 extract was also prepared from B-95.ΔA cells [45], which are devoid of the gene for RF1 and grow more slowly.

Cell-free protein synthesis reaction. Cell-free protein synthesis reactions were carried out in dialysis mode at 30 °C for 10-14 h as described earlier [3] with some modifications. The inner chamber reaction mixtures contained 55 mM HEPES-KOH (pH 7.5), 1.7 mM DTT, 1.2 mM ATP, 0.8 mM each of CTP, GTP and UTP, 0.64 mM 3’,5’-cyclic AMP, 68 µM folinic acid, 27.5 mM ammonium acetate, 208 mM potassium glutamate, 80 mM creatine phosphate, 250 µg/mL creatine kinase, 15 mM magnesium acetate, 175 µg/mL E. coli total tRNA and 20% (v/v) of S30 extract. DNA template was provided as PCR-amplified product from a construct with T7 RNAP promoter, a ribosome binding site and a terminator [5].

Mass spectrometry. For all protein samples produced by cell-free synthesis, the efficiency of amber suppression was analysed using mass spectrometry. An Elite Hybrid Ion Trap-Orbitrap mass spectrometer (Thermo Scientific) coupled with an UltiMate S4 3000 UHPLC (Thermo Scientific) was used to analyse masses and 7.5 pmol of sample were injected to the mass analyser via an Agilent ZORBAX SB-C3 Rapid Resolution HT Threaded Column (Agilent) [57]. In-gel digestion of Coomassie-stained protein bands isolated by gel electrophoresis for MALDI-MS or LC-MS/MS analysis used the protocol described by Shevchengo et al. [58] to identify proteins in a proteomics approach.

NMR spectroscopy. All NMR data were recorded at 25 °C on a Bruker Avance II 800 MHz NMR spectrometer equipped with a TCI cryoprobe. [15_N,1_{H]-HSQC spectra were recorded} using t1max = 40 ms, t2max = 106 ms and total recording times of about 40 min.

97

4.3.

Results

In vivo assay. In order to test the ability of the MtLRS/HbLtRNApair to suppress the amber stop codon in vivo, one copy of the MtLRS gene (with T7 promoter and terminator) together with one copy of HbLtRNA (under the lpp promoter and rrnC terminator) were cloned into pCDFDuet™ (Novagen) (Figure 4.3). The pCDF plasmid was transformed into B-95.ΔA cells together with a pET plasmid for expressing GFP protein (45.5 kDa) with N-terminal His6-tag and an amber codon at position N53. The GFP gene was under control of the T7 RNAP promoter so that induction with IPTG triggered the expression of both MtLRS and GFP. Recognition of HbLtRNA by MtLRS thus was expected to result in expression of full-length GFP. As shown in Figure 4.3c, green fluorescent colour was indeed visible after IPTG induction and the production of full-length protein was confirmed by 12% SDS-PAGE of purified His6-tagged GFP (Figure 4.3b). Due to the high molecular weight of GFP, however, mass spectrometry failed. It is thus possible that a different residue was inserted in response to the amber codon, as the B-95.ΔA strain has often been observed in our laboratory to decode amber codons as glutamine (Choy-Theng Loh, personal communication).

Figure 4.3In vivo efficiency of the HbLtRNA/MtLRS pair for amber suppression using GFP N53TAG as reporter protein. a) pCDF plasmid carrying a copy of MtLRS under control of a T7 promoter and a copy of HbLtRNA under the llp promoter. This plasmid was transformed into E. coli B-95.ΔA cells. b) Expression of full-length GFP confirmed by SDS-PAGE. c) Expression of GFP indicated in the left tube by green fluorescence after IPTG induction.

98

E. coli BL21(DE3)pLysS cells with a pET vector including the gene for the Zika virus protease (ZVP) with L112TAG mutation. ZVP has a smaller size (24 kDa) compared with GFP, which facilitates analysis by mass spectrometry. Repeating the same procedure as for GFP, His6- tagged ZVP was purified and the purity of the protein was estimated by 12% SDS-PAGE (Figure 4.4a). Mass spectrometry was carried out after desalting and diluting the protein to 20 µM (Figure 4.4b). The results showed incorporation of leucine occurred in only about 25% of the final protein, whereas the highest peak indicated glutamine incorporation.

Figure 4.4 In vivo efficiency of the HbLtRNA/MtLRS pair for amber suppression of ZVP L112TAG in E. coli BL21(DE3)pLysS cells. a) Expression of full-length ZVP confirmed by 12% SDS-PAGE. c) Mass spectrometry result for purified ZVP showed incorporation of about 25% leucine and 75% glutamine.

Abera Saeed [15] carried out similar experiments for phenylalanine incorporation using phenylalanyl-tRNA synthetase (MjFRS) and tyrosyl-tRNA (MjYtRNA). Successful incorporation of phenylalanine into ZVP S81TAG was confirmed using mass spectrometry (Figure 4.5). The complete incorporation of desired amino acid without any misincorporation of other natural amino acids demonstrated the high efficiency of the synthetase.

99 Figure 4.5 Confirmation of complete suppression of TAG codon with phenylalanine using the

MjFRS and MjYtRNA pair in vivo using B-95.ΔA cells. The expected mass for ZVP with phenylalanine at position 81 was 24718.50 Da (Figure reproduced from [15] with permission).

DNA template for tRNA transcription. The sequential PCR method [47] was used to construct the DNA template of HbLtRNA in 4 steps as shown in Figure 4.6. Step 1 used the primers HbLtRNA-F and HbLtRNA-R1, step 2 the primers HbLtRNA-F and HbLtRNA-R2 and step 3 HbLtRNA-F and HbLtRNA-R3. In each step, a piece of the tRNA gene was added to construct the final DNA template. In step 4, the DNA template was amplified using primers

HbLtRNA-F and HbLtRNA-R4, where the first two nucleotides of the reverse primer were C2’-O-methylated to produce the final DNA template with the first two nucleotides of the 5’- end modified with methoxy groups. The DNA construct for MjFtRNA was also prepared in this way, whereas the DNA template of ScQtRNA was ordered as a gBlock from IDT. The sequence of ScQtRNA had an overall GC content of 51% with no GC-rich regions and could be obtained commercially as double-stranded DNA.

100 Figure 4.6 Sequential PCR to produce the DNA template for in vitro tRNA transcription. Due to the high GC content of HbLtRNA, synthesis of the DNA template was only possible using multiple-step PCR, where a small segment of the tRNA was stepwise added to the DNA template to yield the full-length construct.

HbLtRNA transcription. The conditions for tRNA transcription were optimized for

HbLtRNA. Initially, the in vitro tRNA synthesis reaction was set up using commercial T7 RNAP from NEB (New England, USA). A 20 µL reaction containing 1x reaction buffer (40 mM Tris-HCl, 6 mM, MgCl2, 1 mM DTT, 2 mM spermidine pH 7.9), 4 mM NTP, 16 mM CMP, 14 ng/µL DNA template, 5 mM DTT (stock solutions were freshly prepared) and 100 units of T7 RNAP (about 0.041 mg/mL) was carried out at 37 °C for 3 h (tRNA transcription), 75 °C for 20 minutes (T7 RNAP deactivation) and 60 °C for 1 h (ribozyme autocleavage). A 5 µL aliquot of the reaction was run on a 1% agarose gel and stained with either RedSafe (iNtRON, USA) or SYBR gold (Invitrogen, Thermofisher, USA). Figure 4.7 shows that the transcripts contained two bands, suggesting incomplete autocleavage of the hammerhead ribozyme.

101 Figure 4.7 Testing the efficiency of initial transcription conditions using commercial T7 RNAP (NEB). Two separate 1% agarose gels were prepared and stained with either RedSafe (a) or SYBR gold (b) in a beaker containing 100 mL TAE buffer and 2 µL dye. Lane 1: 5 µL of transcription reaction; lane 2: 2-log DNA ladder (NEB); lane 3: 1.75 mg/mL commercial total tRNA (Roche); lane 4: 0.175 mg/mL of commercial total tRNA (Roche). Orange, blue and red arrows indicate DNA template used for transcription (656 nt), uncleaved hammerhead + tRNA (136 nt) and tRNA after autocleavage of hammerhead (88 nt), respectively.

Effect of MgCl2 on the transcription reaction. To investigate the effect of MgCl2 on the tRNA transcription reaction, the same reaction was performed as in Figure 4.7 with additional MgCl2 in concentrations varying between 6 mM to 18 mM. As shown in Figure 4.8, 12 mM MgCl2 (Lane 3) delivered a slightly better performance in final yield of cleaved tRNA (red arrow) compared to 6 mM (Lane 1) and 18 mM MgCl2 (Lane 4). As each nucleotide triphosphate can chelate one Mg2+ _{ion, the optimal concentration of Mg}2+ _{ions may be expected} to be 16 mM (each NTP was used at 4 mM concentration). The fact that 12 mM MgCl2 produced more tRNA than 18 mM MgCl2 may be attributed to lower autocleavage activity of the hammerhead ribozyme at higher concentration of MgCl2 (Figure 4.8).

102 Figure 4.8 Effect of MgCl2 concentration on final tRNA transcription yield using commercial T7 RNAP (NEB). 5 µL of each reaction was run on 1% agarose gel and stained with RedSafe. Lane 1: 6 mM MgCl2; lane 2: 2-log DNA ladder (NEB); Lane 3: 12 mM MgCl2; lane 4: 18 mM MgCl2. Blue and red arrows indicate uncleaved hammerhead + tRNA and tRNA after autocleavage of hammerhead, respectively.

Home-made T7 RNAP. Due to the cost of commercial T7 RNAP, home-made enzyme was prepared as a recombinant protein in E. coli. A final concentration of 0.032 mg/mL was used and the activity of the enzyme in tRNA transcription was investigated. The results are shown in Figure 4.9. The home-made T7 RNAP (lane 3) showed reduced efficiency compared with the commercial enzyme (lane 1). Removing CMP from the reaction or decreasing the amount of DNA template also slightly reduced the final yield, but not very much. All subsequent experiments were carried out using home-made T7 RNAP.

When the tRNA starts with G, addition of GMP in the transcription reaction helps increase the initiation rate of T7 RNAP and produce transcripts with a 5’-OH or 5’- monophosphate end instead of a 5’-triphosphate [26]. Unfortunately, HbLtRNA starts with a