• No results found

CHAPTER 2: IDENTIFICATION OF TIC10 AS A SMALL MOLECULE INDUCER OF TRAIL

2.3 Materials and Methods

All cell lines were obtained from ATCC except HCT116 Bax-/- and HCT116 p53-/- cells that were a gift from Bert Vogelstein (Johns Hopkins University, Baltimore, MA) and glioblastoma cell lines that were kindly provided by Akiva Mintz (Wake Forrest University, Winston-Salem, NC). Cells were maintained at 5% CO2, 95% air, 37°C in water-jacketed incubators (Forma Scientific). Cell

culture media was typically obtained from Gibco and mixed with 10% sterile-filtered fetal bovine serum and 1% penicillin/streptomycin. Parental cell lines were maintained in canted neck, tissue culture treated flasks (BD Falcon). For most experiments, cells were propagated in 6-well culture plates (Corning Incorporated) and allowed to adhere for a minimum of 12 hours prior to drug treatment in fresh media. Cells were enumerated using a Cellometer Auto T4 (Nexcelom Biosciences).

Reagents

D-luciferin (Gold BioTechnology, Inc.) was reconstituted in PBS and stored at -80°C. Propidium iodide was suspended in dH2O and stored at -20°C.

High throughput Screening

We performed cell-based screening for TRAIL-inducing using a luciferase reporter assay. The reporter for the screen was luciferase under transcriptional control of the first 504 base pairs of the human TRAIL gene promoter. This construct was transfected into HCT116 Bax-/- that were seeded into 384-well black plates (Corning) at a density of 5 × 104 cells per well. Compounds were added to the well at concentrations of 20, 200, 500, and 1000 nM using robotically controlled pin tools (Biomek). Treatments were carried out in duplicate and plates were treated in duplicate to allow for readout of the reporter as well as a cell viability assay. Reporter activity and cell viability was imaged at 12, 24, 36, and 48 hours following treatment using an IVIS imaging system (Xenogen). The luciferase reporter signal was normalized to cell viability for data interpretation.

RT-qPCR analysis

Total RNA was extracted using RNeasy Minikit (Qiagen) by following the manufacturer’s instructions. cDNA was generated using SuperScript II (Invitrogen) with 1 µg of RNA and oligodT. Primers were: TRAIL forward (CAGAGGAAGAAGCAACACATT), TRAIL reverse (GGTTGATGATTCCCAGGAGTTTATTTTG), GAPDH forward (CCACATCGCTCAGACACCAT), GAPDH reverse (GGCAACAATATCCACTTTACCAGAGT). PCR amplification was performed with the Applied Biosystems 7900HT Fast Real-time Detection System. Samples were standardized to 10 ng/µl and 20 ng of cDNA per sample was then utilized as a template for real- time PCR using a SYBR Green Master Mix (Qiagen Corp, USA). Quantitation used the 2∆∆Ct method of crossing thresholds (Livak and Schmittgen, 2001) with GAPDH as the endogenous control for normalization. Reactions were performed in 384 well optical plates in a 7900HT instrument (Applied Biosystems), with 10ul reaction volumes. Data analysis used the ABI PRISM 7900 Sequence Detection System 2.2 software. To exclude the possibility of genomic DNA contamination, control PCR reactions with no cDNA template and No-RT control samples were also performed for each gene-specific primer set. Replicates of each PCR reaction were performed and the resultant data was averaged.

Surface TRAIL expression by flow cytometry

Cells were harvested by trypsinization and rinsed once in PBS. Cells were then fixed in 1mL of 4% paraformaldehyde in PBS for 20 minutes at room temperature. Cells were then rinsed twice in PBS and incubated with the anti-TRAIL primary antibody (Abcam) at 1:200 in PBS overnight at 4°C. Cells were rinsed twice and incubated with anti-Rabbit Alexafluor 488 (Invitrogen) at 1:250 for 1 hour at room temperature protected from light. Cells were rinsed in PBS, resuspended in 300 µL PBS, and analyzed by flow cytometry.

Cell cycle/Sub-G1 analysis

Cells were harvested from log-phase growth in cell culture in 6-well plates under indicated treatment conditions using brief trypsinization and collecting both adherent and floating cells. Cells were centrifuged for 5 minutes at 1100RPM, rinsed in PBS, and resuspended in .5mL of PBS. 5mL of chilled 80% ethanol was added dropwise while vortexing. Cells were then stored at 4°C for 30 minutes and further processed or stored at 4°C for analysis later. Cells were then centrifuged, washed in 2mL of PBS, and resuspended in 1mL of PBS. .5mL of phosphate-citric acid (.2M Na2HPO4, 4µM citric acid, pH 7.8) was added and the solution was incubated for 5

minutes followed by centrifugation. Cells were then resuspended in 300µL of PI/RNase staining solution (50 µg/mL PI and 250 µg/mL RNase A in PBS) and analyzed by flow cytometry. Data was processed using WinMDI version 2.8 software.

Mass spectrometry

Samples were analyzed on an Acquity Ultra Performance Liquid Chromatography (UPLC) system coupled to a Waters SYNAPT qTOF mass spectrometer. The column, which was kept at 40°C, was a Waters UPLC C18 2.1×50 mm with 1.7 µm particles. The binary solvent system included A. water containing 0.1% formic acid and 10mM ammonium formate and B. acetonitrile containing 0.1% formic acid. The gradient started from 10% A with a linear gradient to 50% B. The total run time including re-equilibration step was 8 min with a flow rate of 0.200 ml/min. The temperature of the sample organizer was set at 8°C. Approximately 2pmol of compound was injected. The compound was analyzed by electrospray ionization in positive ion mode. The data were collected at mass range of m/z 50–1000 with a scan duration of 0.2 sec. The source temperature was set at 120°C and nitrogen was used as desolvation gas (700 L/h) at 400°C. The voltages of the sampling cone and capillary were 35 V and 3.5 kV, respectively. Leukine Enkephalin was used as the lockspray reference compound (10 µl/min; 10 sec scan frequency). Tandem mass spectrometry was used for the generation of fragment ions. MS/MS was performed with a collision energy ramp from 20 to 50V. Elemental composition and assignment of structures to observed fragment ions were performed using MarkerLynx software.

Production of Recombinant TRAIL

30mL of LB with ampicillin (100µg/mL) was inoculated at 1:10,000 with bacteria transformed with the His-tagged TRAIL construct and incubated overnight in the shaker. The next day, the overnight culture was diluted 100 fold in LB with ampicillin and incubated for 2 hours in the shaker. IPTG was added at .5 mM working concentration and grown for 2.5 hours in the shaker. 1mL samples were taken before and after induction with IPTG. Cells were pelleted at 7000 RPM for 10 minutes and resuspended in 8mL of binding buffer (50 mM HaH2PO4, 300mM NaCl, 10mM

imidazole, 10mM β-mercaptoethanol, pH 8.0). Lysozymes was added at 1mg/mL and incubated on ice for 30 minutes. The mixture was sonicated (3M, setting 2.5, 20s X 4) and centrifuged at 17,000 RPM for 30 minutes. The supernatant was removed and 1mL of Ni-NTA slurry (Invitrogen) was added and mixed at 4°C while rotating for 1 hour. The beads were centrifuged at 1000 RPM for 5 minutes at room temperature and 50uL was removed for subsequent analysis. The beads were resuspended in 2mL of Washing Buffer (50mM NaH2PO4, 300mM NaCl, 20mM imidazole,

10mM β-mercaptoethanol, pH 8.0) and loaded into a small empty column. After the beads were packed, the outlet was unstopped, and the column was washed with 2 column volumes of Washing Buffer. The protein was eluted with 700µL of Elution buffer (50mM NaH2PO4, 300mM

NaCl, 250mM imidazole, 10mM β-mercaptoethanol, pH 8.0) for 3 times and collected as separate fractions. The induction and purity of fractions were determined by standard SDS-PAGE. Dialysis was performed twice in 1L of PBS containing 30% glycerol and 10mM β-mercaptoethanol for 1 hour at 4°C. The protein concentration was determined by BioRad protein assay according to the manufacturer’s protocol.

Statistical Analyses. For pair-wise comparisons, we analyzed data by the Student’s two-tailed t

Related documents