• No results found

2 .1 Materials; Cosmid libraries

Cosmids used in the mapping of the Y chromosome were derived from two libraries. The 3E7 library was prepared by Kay Taylor (Taylor etal., 1996) from the somatic cell hybrid 3E7. DNA was partially digested with Sau3A 1 and ligated into the BamHI sWe of LoristB. 1728 clones containing human inserts were isolated by hybridisation with total human male DNA and gridded into microtitre plates The LL0YNC03"M" library was prepared by Pieter de Jong using Y chromosomes flow-sorted from the cell line J640-51 ligated into Lawrist 16 and consists of 13000 clones, about 15% of which are of hamster origin. The majority of the cosmids used in the mapping of 9q34 are derived from the

LL09NG01"P" library, which was also prepared by Pieter de Jong in Lawrist 16 and contains 30000 clones. Clones have also been isolated from the human total genome library made by B Cachon-Gonzalez (Cachon-Gonzalez 1991).

150 human cosmids were cloned from cell line 640-63-a12 by F Florian (Florian

et a/., 1991). 192 human cosmids were cloned from cell line E6B (Henske et a/., 1992) and were made available by D Kwiatkowski. 15 clones were made from the IFGT cell lines JF17B and JF20A by Jude Fitzgibbon and Karen Woodward. 85 clones mapped to 9q34 by FISH were provided by Y Nakamura and 8 G raw.

2 .2 Materials; Sources of large cloned DMAs

YAC clones 35HG8 and 15GF1 and cosmids derived from the YAC C11- C (Zhou ef a/.,1995) were provided to us by R. Furlong. PAC clones 63F12, 145N8 and 213M24 were obtained by PCR screening of the PAC human

genomic library constructed by Pieter de Jong, with primers for D9S164 and for P6 (M. Smith, unpublished primer sequences). PCR pools and clones were

accessed via the HGMP Resource Centre. P1 clone DMPG-HFF1-0529F4, which was positive for ABO, was provided by H. Clausen (Bennet et al., 1995). BAC clone 9E21 was provided by J. Korenburg.

2 .3 Materials; Irradiation hybrids

The production of radiation hybrids from the somatic cell hybrid line 640- 63-A12 using a high dose of radiation (40000 rads) is described in Florian et al.

(1991) and in Nahmias etal. (1995). In each of the two experiments 5x106cells of 640-63-a12 were exposed to 45,000 rads at room temperature at 1000 rads per minute. The killed cells were rescued by fusion to W3GH cells. After 24h incubation at 37°C HAT was added. Colonies were picked after 14 days. In the experiment carried out by Jude Fitzgibbon and described in Nahmias et al.

(1995) 39 hybrid lines were produced and were tested for the retention of 23 loci from 9q. 25 of the 39 lines were positive with at least one of these loci. Those lines positive only with loci in 9q34 were further characterised using additional 9q34 markers. These lines were also investigated by FISH, both by probing labelled hybrid DNA onto metaphase spreads of human chromosomes and by probing metaphase spreads of the hybrid cells with labelled human DNA. 3 of these hybrids have been used to isolate cosmids derived from 9q34 (see below).

To prepare DNA cells were washed in physiological saline solution and then incubated for 5h at 37°C in 0.5%SDS 10Omg/ml Proteinase K. The lysate was extracted with phenol/chloroform and the DNA was ethanol precipitated and resuspended in TE.

The third set of radiation hybrids, which was prepared with a lower radiation dose (4000 to 8000 rads) is described in Henske et al. (1992).

Hybridisation probes from radiation hybrids, YAC BAG or PAG clones were generated by inter Alu PGR using primers AlulV (GAGAATTGGGGAGAG- AGGGAGAGTGGGTGTT Gotter etal., 1991) which primes from the 3' end of the

Alu sequence and 5R' (GAAGTGGTGAGGTGAG-GTGATGGAG Nahmias etal.,

1995) priming from the 5' end. Approximately 1|xg of hybrid DNA or lOOng of DMA from YAG, BAG or PAG clones was amplified in a buffer consisting of lOmM Tris.HGI (pH 8.3), 50mM KGI, I.SmM MgGl2, 0.02% gelatin, 0.01% Tween 20, 0.1% Triton X-100, 0.1%0.1% Nonidet NP-40, 200|liM each dNTP,

1|iM primer or O.SpM each primer and 2U Tag polymerase in a volume of 100|liI.

Initial dénaturation was at 94°G for Smins. Amplification was for 35 cycles; 94°G for 45s, 56°G for 60s and 72°G for 180s. Alu IV and 5'R primers were used individually except for the amplification of the two YAGs around D9S195, where an increase in product complexity was seen by using both primers together. After amplification lOpI of product was run on a 1.5% agarose gel to check that an appropriate level of amplification had taken place. The remaining 90|il of product was ethanol precipitated, resuspended in 20)il of TE and used to make hybridisation probes as in section 2.7, below.

2 .5 Materials; Single copy probes

Probes made by RT-PGR were provided by Alison Pilz for the genes G8G, RXRA, GEL, GAN, ENG, PAPPA, PAEP and G0L5A1 (Pilz etal., 1995). A SURF-3 oligonucleotide probe was provided by B Janssen. Gloned fragments of genes and markers were provided as follows: ABO (F Yamamoto); v-ABL (N Tyke); FPGS (B Shane); PBX3 (T Bech-Hansen); GRIN1 (P Brett); DBH (J Mallet) PTPA (J. Goris) and D9S10-MGT136 (R White). Gloned fragments of N0TGH1, ASS and ABG2 were obtained from the American Type Gulture Gollection.

Probings with ABO, MCT136 (D9S10), PTPA, FUT7 and P6 were done by myself. For ABO, MCT136 (D9S10) and PTPA plasmid DNA was restriction digested and separated on a 0.8% agarose gel. The insert bands were cut out of the gel and DNA recovered by centrifugation through glass wool at 13000rpm in a microfuge, ethanol precipitated and resuspended in TE. Probes from FUT7 (primers CTCGGACATGTTTGTGCCGTATG and GGGAGAATTTGTGGGTAATG- TAG, Reguine-arnould etal., 1996) and P6 (unpublished primers, provided by

M.Smith) were both amplified by PGR from lOOng of total human DNA in a volume of 50pl using 0.5|iM primers, 1U of Amersham Taq polymerase and the buffer provided by the manufacturer, containing 1 .5|liM MgGl2. Dénaturation was at 94°G for Smins and amplification was for 30 cycles; 94°G for 30s, 55°G for 15s and 72°G for 30s. Products were separated in 1.5% agarose gels and product bands were excised and DNA purified as for ABO, above. Probes were radiolabelled and hybridised to cosmid libraries as in section 2.7, below.

2 .6 Materials; Cosmids derived from 9q34

2.6.1 Isolation of cosmids using large cloned DMAs

2.6.1.1 Isolation of cosmids from libraries, using radiation hybrids

Three radiation hybrids were used to isolate cosmid clones from the LL09NG01"P" cosmid library. These cell lines are part of a panel that was produced and characterised by Jude Fitzgibbon as part of his doctoral work (see above). This panel of hybrids was produced by irradiation with a relatively high dose of X-rays that breaks the chromosomes into pieces expected to be much smaller than the 10Mb of 9q34, and hence to be useful for mapping within this region. 3 of these lines, JF17B, JF19B and JF20A were chosen as being suitable for use in isolating cosmids from 9q34 (see figure 4). Between them they cover most or all of the TSG1 candidate region with a minimum of DNA

from outside 9q34. From the hybridisation data available it is still possible that there might be areas uncovered by the hybrids between ABO and D9S149.

The work of isolating cosmids with these hybrid lines is described in Nahmias et al. (1995). PCR was carried out on the three lines using primers from the 3' and 5' ends of the Alu sequence separately. These six probes were labelled and hybridised to filters of the LL09NC01"P" library. A total of 1,950 signals were seen, corresponding to 1,431 different cosmids. There was substantial overlap in the sets of cosmids found by the probes from the 3 hybrids, corresponding to regions of genomic DNA where these hybrids overlap.

C E N T R O M E R I C JF17B JF19B JF20A E6B