• No results found

Molecular cloning 36

2.2   Materials and methods 36

2.2.1   Molecular cloning 36

Constructs used for this study are listed in Table 2-2, and the list of primers used for the DNA amplification and sequencing reactions are provided in Table 2-3. Molecular cloning was carried out according to the standard protocols (Sambrook & Russell, 2001).

2.2.1.1

Cloning of pAK-SecA-N68ΔC

The coding sequence for SecA-N68ΔC (residues 1-590 of wild-type SecA) was amplified from

pZ52-SecA (originally pT7SecA2 (Rajapandi et al, 1991)) using primers F-AK-N68ΔC and R- AK-N68ΔC (Table 2-3). PCR was carried out using PfuTurbo DNA polymerase with the following procedure: an initial denaturation step at 96 °C for 5 min was followed by the first cycle (96 °C for 3 min, 54 °C for 4 min, and 72 °C for 6 min); the reaction was continued for 30 cycles (96 °C for 45s, 51 °C for 45s, and 72 °C for 4 min 25s); the reaction was completed with

an extension step for 15 min at 72 °C. The amplified DNA band was gel-purified and ligated between the BamHI and SspDI cut sites of the expression vector pProEX-HTa (Invitrogen) with T4 DNA ligase. The resulting plasmids were transformed into DH5α cells. DNA sequencing

using primers listed in Table 2.3 confirmed that no unwanted mutations were introduced.

2.2.1.2

Cloning of pAK-SecA-N68 and pAK-SecA-N68ΔNC

Both constructs were made in a pProEX HTa background vector. For creating pAK-SecA- N68ΔNC, the EcoRI fragment from pAK-SecA-N68ΔC was inserted in EcoRI sites of pJH-N68-

ER1-ER2. For constructing pAK-SecA-N68, the EcoRI fragment of pZ52-70H (His6-SecA-N68) vector was inserted in EcoRI sites of pAK-SecA-N68ΔC. Vectors were treated with Antarctic

Phosphatase to reduce the self-ligated vector background. The correctly oriented vectors were selected by analyzing the restriction digestion pattern of vectors (by XhoI and BglII double digestion pattern). Both vectors were sequenced to verify the accuracy of the coding region of the SecA construct.

2.2.1.3

Construction of pAK-SecA-N68ΔN

For cloning of pAK-SecA-N68ΔN, the NcoI fragment of pZ52-70H (His6-SecA-N68) vector was inserted into NcoI site of pJH-N68-ER1-ER2 (construct with truncated 14 N-terminal residues). The correctly oriented SecA-N68ΔN vectors were selected by analyzing the restriction digestion

pattern by EcoRI and further confirmed by DNA sequencing.

2.2.1.4

Cloning of pAK-SecA-N95ΔN

The EcoRI fragment from pBSWT plasmid (His6-SecA-N95 (Shilton et al, 1998)) was ligated between the EcoRI sites of pAK-SecA-N68ΔN. pAK-SecA-N68ΔN vector’s backbone was

treated with Antarctic Phosphatase to reduce the self-ligated vector background. After successful transformation, vectors with the right orientation of the insert were selected by analyzing the SDS-PAGE pattern of protein expression (as the correctly oriented segments were expected to express a protein around 95 kDa (SecA-N95ΔN)). Consequently, the plasmid extraction was

2.2.1.5

Cloning of pAK-SecA-N95ΔN(T109N)

pAK-SecA-N95ΔN(T109N) was produced as follows. The NcoI segment of pBST109N (His6- N95(T109N) (Shilton et al, 1998)) was ligated into the NcoI site of pProEX-N95∆N vector. Vector’s backbone segment was treated with Antarctic Phosphatase to reduce the self-ligated vector background. The resulted DNA mixture was transformed in E. coli. The right oriented constructs were selected by analyzing the protein expression pattern, and subsequent DNA sequencing.

2.2.1.6

Cloning of pAK-SecA-N95(T109N)

For generating the pAK-SecA-N95(T109N) construct, the NcoI fragment of pBST109N (His6- SecA-N95(T109N) (Shilton et al, 1998)) was inserted into the NcoI cut site of pJZ7-N95 vector (which is a derivative of pZ52-SecA with a stop codon after 835th amino acid). After transformation, the correctly oriented constructs were selected by analyzing the protein expression pattern as described above. Further DNA sequencing confirmed the desired results.

2.2.1.7

Construction of pAK-SecA-N95ΔN14

For generation of the pAK-SecA-N95ΔN14 vector, which does not carry the cleavable N-

terminal affinity tag, for in vivo complementation analyses, a PCR mutagenesis method was used. Primers F-AK-N95ΔN14 and R-AK-N95ΔN14 (See Table 2-3 for the sequences of primers) were used in a PCR based on Klock and Lesley’s procedure (Klock & Lesley, 2009) on the pJZ7-SecA-N95 plasmid (pZ52-SecA that carries a stop codon after 835th residue). After optimization of the PCR reaction, the generated DNA was treated with DpnI for 2 hours at 37 ºC. Then the vectors were transformed into the DH5αE. coli cells.

Table 2-2. List of the SecA constructs and expression vectors used in this chapter Construct Plasmid Features

SecA-N68ΔNC-ER pJH-N68-ER1-ER2

Residues 15-590 in pProEX-HTa; carries entropy-reducing (ER) mutations: E55A, K56A, E58A, E196A, and E197A. Has a cleavable N- terminal His-tag

SecA pZ52-SecA Residues 1-901. Originally pT7SecA2

His6-SecA-N68 pZ52-N70H

Residues 6-609. Derived from pZ52-SecA. Has a non-cleavable N-terminal His-tag, which has modified the very N-terminal sequence from the wild-type sequence of MLIKLLTKVFG to MHHHHHHLTKVFG

SecA-N68 pAK-SecA-N68 Residues 1-609 in pProEX-HTa; cleavable N-terminal His-tag

SecA-N68ΔN pAK-SecA-N68ΔN Residues 15-609 in pProEX-HTa; cleavable N-terminal His-tag

SecA-N68ΔNC pAK-SecA-N68ΔC Residues 15-590 in pProEX-HTa; cleavable N-terminal His-tag

SecA-N68ΔC pAK-SecA-N68ΔNC Residues 1-590 in pProEX-HTa; cleavable N-terminal His-tag SecA-N95 pJZ7-SecA-N95 Residues 1-835. Derived from pZ52-SecA.

His6-SecA-N95 pBSWT

Residues 6-835. Has a non-cleavable N-terminal His-tag, which has modified the N-terminus sequence from the wild-type sequence of MLIKLLTKVFG to MHHHHHHLTKVFG SecA-N95ΔN pAK-SecA-N95ΔN Residues 15-835 in pProEX-HTa; cleavable N-terminal His-tag

SecA-N95(T109N) pAK-SecA-N95(T109N) Residues 1-835. Derived from pZ52-SecA. Mutation T109N

SecA-N95ΔN(T109N) pAK-SecA-N952.2.1.7.1.1.1.1 ΔN(T109N) Residues 15-835 in pProEX-HTa; cleavable N-terminal His-tag. Mutation T109N

SecA(T109N) pZ52-SecA(T109N) 2.2.1.7.1.1.1.2 Residues 1-901. Derived from pZ52-SecA. Mutation T109N

Table 2-3. List of the primers used in this chapter.

Primer Sequence Length Use

F-AK-N68ΔC 5’- ATCTGAGGCGCCATGCTAATCAAATTGTTAACTAAAGTTTTCGGTAG 47 Cloning

R-AK-N68ΔC 5’- CCTGATGGATCCTTACATCGACAGGTAGAAACGGGAAG 38 Cloning

F-AK-N95ΔN14 5’- TGAGATTTTATTATGGATCGCACCCTGCGCCGGATG 36 Cloning

R-AK-N95ΔN14 5’- CATAATAAAATCTCAAACGCCCCGCGTTGC 30 Cloning

F-AK-pProEX 5’- TAACAATTTCACACAGGAAACAGACC 26 Sequencing

R-AK-pProEX 5’- TTCTCTCATCCGCCAAAACAGC 22 Sequencing

4362-1 5’- GAGATGGAAAAACTCTCCGACG 22 Sequencing 4313-2 5’- GAATACGGCTTTGACTACCTG 21 Sequencing 4313-3 5’- GCTGCGCGCTCATGCGC 17 Sequencing 4313-4 5’- GCCAGCCGGTGCTGGTGG 18 Sequencing 4313-5 5’- GGGGATGCTGGTTCTTCC 18 Sequencing 4313-6 5’- TGGGATATTCCGGGGCTGC 19 Sequencing