2.6 MOLECULAR ANALYSES
2.6.2 Mutation Analysis
Mutation analysis was conducted by allele-specific real-time PCR using custom TaqMan- MGB allelic discrimination assays (Applied Biosystems). The sequences of the primers and probes are listed in the Tab.S3. Every well contained 20 ng of purified gDNA template. Samples were run in duplicates in the final volume of 10 μl with TaqMan Universal PCR Master Mix (2x) No AmpErase UNG, 40 x working stock of allele-specific assays and blocking oligonucleotides (125 nM). Amplification was run in the ABI Fast 7500 instrument. Standard TaqMan thermocycling conditions were used (10 min - 95˚C, 40 cycles of 15 s at 92 ˚C, 1 min at 60˚C) for all mutation analyses, except for the BRAF anneal/extend step, which was prolonged to 90 s. Every 96-well plate was composed of 40 patients‟ samples in duplicates, 4 negative controls (WT), 8 positive controls (titrations), and 4 non-template controls (NTC).
35 2.6.2.1 The principle of the allele-specific real-time PCR
Allele-specific real-time PCR was designed to detect DNA sequence variants that differ in only one nucleotide. A sequence of interest, investigated for the mutation status, is flanked by a pair of primers. Each assay contains two probes: one is labeled with a fluorescent dye FAM and another with a fluorescent dye VIC. FAM- labeled probe binds to the mutated sequence and VIC-labeled probe detects a wild-type sequence. The process of amplification leads to the hydrolysis of the probe by Taq's 5' to 3' exonuclease activity. A dye from the matched probe is released and the fluorescent signal is generated. Black hole quencher prevents fluorescence of the non-matching probe. Specificity of the assays is improved by the minor groove binder (MGB) that forms stable duplexes with the single-stranded DNA targets.
Titration - serial dilution of mutant allele with wild-type gDNA
Originally, allele-specific real-time end-point assays are designed to generate three types of signal. A substantial increase in FAM fluorescence indicates a homozygous mutant, a VIC signal indicates a homozygous wild-type, and finally increase in both signals indicates heterozygosity and an intermediate signal is generated by the software (Fig.2.3).
Majority of the somatic mutations in cancer is dominant and normally affect only a single allele of the gene. Homozygous mutations in cancer genomes occur seldom, in most of the cases as a result of the LOH (loss of heterozygosity) in which a germ-line mutation in one allele is followed by a subsequent somatic alteration. Therefore, in most of the cases both probes are binding and an intermediate signal is generated. Moreover, tumour tissue samples are genetically heterogeneous. They often contain, apart from tumour cells, a variety of other components such as surrounding stroma or the inflammatory cells. Commonly, due to the complicated sample architecture, an adjacent tissue cannot be removed by macropreparation. Only tumour cells carry somatic mutations, therefore an isolation of DNA from such a cell mixture leads to an increase of wild-type sequence fraction. Ultimately, an increase of the VIC signal is observed. Due to the challenging interpretation of the allele-specific real-time PCR, an analysis of serial dilutions of the mutant samples with the wild-type genomic DNA (titration) was conducted on every plate. In order to interpret the results and to decide whether the sample was mutated or not, a ratio of the FAM and VIC was analyzed along with the visual analysis of the scatter plots and in comparison with the titrations.
36
Fig.2.3. Scatter plot illustrates endpoint
determined exemplary groups of homozygous
(mutant and wild-type) and heterozygous samples.
Each cross represents one analyzed sample.
Increase in FAM (mutant) signal shifts the samples
to the upper part of the plot (blue crosses), while
the fluorescent signal from VIC (wild-type) shift the
samples to the right (red crosses). An intermediate
signal generated from both FAM and VIC
fluorescent signals (green crosses) indicated a
hezerozygous sample.
2.6.2.2 Blocking non-labeled oligonucleotides
In some of the cases, during the pilot experiments, more than one mutation was detected in the same sample, particularly in codon 12 of the KRAS gene. It was caused by the fact that six assays, which were designed to detect different mutations in KRAS codon 12, differ in one nucleotide only (Fig.2.4). Such similarity led to the binding in the fraction of the imperfectly matched probes and to generation of the unspecific signal. This cross-reactivity resulted in the challenging interpretation of the preliminary results. In order to prevent nonspecific binding, unlabeled oligonucleotides were added to the reactions. These unlabeled oligonucleotides were competitive with the unmatched probes and blocked their binding position. They prevented generation of nonspecific fluorescence signals that originated from the unspecific mutations in codon 12 of the KRAS gene. The combinations of the probes and blocking oligonucleotides are shown in table 2.2.
Fig.2.4.
Distribution of
mutations in codon
12 and 13 in the
KRAS gene and
their frequency in
the CRC
population
(source: COSMIC
database -
modified)
Homozygous mutant AA Heterozygous mutant AB No amplification Wild-type BB37
Tab.2.2 Combinations of the probes and blocking oligonucleotides
Assay ID Target Mutation Blocker ID Blocker sequence Blocker(s)used in the reaction
KRAS_ex2-121a 34 G>A Blocker_121a TAGTTGGAGCTAGTGGCGTAG Blocker_121t KRAS_ex2-121t 34 G>T Blocker_121t TAGTTGGAGCTTGTGGCGTAG Blocker_121a
KRAS_ex2-121c 34 G>C - - Blocker_121a; 121t
KRAS_ex2-122a 35 G>A Blocker_122a TAGTTGGAGCTGATGGCGTAG Blocker_122t; 122c KRAS_ex2-122t 35 G>T Blocker_122t TAGTTGGAGCTGTTGGCGTAG Blocker_122a, ; 122c KRAS_ex2-122c 35 G>C Blocker_122c TAGTTGGAGCTGCTGGCGTAG Blocker_122a; 122t