Northern blot

Chapter 2: Materials and Methods

2.9 Northern blot

2.9.1 Primer design and PCR

Primers (Sigma, UK) for producing RNA probes were designed using Primer3 online tool (see Table 2.1) (Koressaar and Remm, 2007, Untergasser et al., 2012). The reverse primer for each probe had a T7 polymerase promoter sequence at the 5' end.

Table 2.1: List of primers used to design RNA probes for northern blotting. T7 polymerase promoter sequence is depicted in bold.

Target Forward primer _{sequence (5'-‐3')} Reverse primer sequence (5'-‐3')

R2866_101 ccttagttggtttaggttgct ctaatacgactcactatagggagactagataagcggcttttatatg R2866_118 ggaagacaggattggtctc ctaatacgactcactatagggagagtggtggaactaagcagaatt

Standard GoTaq®_{(Promega, UK) PCR was set up as a 50}_μ_{l reaction, using}_H.

influenzae strain R2866 genomic DNA as the template. The PCR conditions were:

1. Initial denaturation at 95 °C

2. Denaturation at 95 °C for 30 seconds 3. Annealing at 51 °C for 30 seconds 4. Extension at 72 °C for 15 seconds 5. Repeat steps 2-‐4 34 times

6. Final extension at 72 °C for 5 minutes

PCR products were checked on 2% agarose gel (see section 2.5.1).

2.9.2 PCR purification

PCR products were purified with the illustraTM_GFXTM_{PCR DNA and Gel Band}

Purification kit (GE Healthcare, UK). 500 μl of kit Capture buffer type 3 was mixed with 40 μl of PCR product, transferred to a spin column, centrifuged at 16,000 g for 30 seconds and the flow-‐through discarded. The centrifugation step was repeated by adding 500 μl of kit Wash buffer type 1. The spin column was centrifuged at 16,000 g for 30 seconds to remove any residual ethanol. DNA was eluted in 17.5 μl of kit Elution buffer type 4 (10 mM Tris, pH 8.0) by centrifuging at 16,000 g for 1 minute. The elution step was repeated for a total of 35 μl of purified PCR product.

2.9.3 Generating the biotin-‐labelled RNA probe

The purified PCR product was used as a template for making the RNA probe. First, the nucleoside triphosphate (NTP) mix was prepared by mixing 2 μl of adenosine triphosphate (ATP), 2 μl of guanosine triphosphate (GTP), 2 μl of cytidine triphosphate (CTP), 0.5 μl of uridine triphosphate (UTP) (100 mM stock

each) and 15 μl of biotin-‐labelled UTP (10 mM stock). Subsequently, RNA transcription was set up by mixing 12 μl of the DNA template (previously purified PCR product), 2 μl of NTP mix, 4 μl of 5x transcription buffer, 2 μl of dithiothreitol (100 mM stock), 2 μl of T7 RNA polymerase and 1 μl of RNasin®_.

All reagents were purchased from Promega, UK. The reaction was incubated for 2 hours at 37 °C in a water bath. 2 μl of 0.2 M ethylenediaminetetraacetate (EDTA) was added to stop transcription.

RNA was precipitated by adding 4.5 μl of 4 M lithium chloride and 75 μl of 100% ethanol and incubating for 2 hours at -‐20 °C. The precipitated RNA probe was centrifuged for 10 minutes at 12,000 g and the RNA pellet was washed with 200

μl of 70% ethanol by centrifuging at 12,000 g for 10 minutes. The RNA pellet was dissolved in 100 μl of RNAse-‐free water and 1 μl of RNasin®_{was added.}

RNA probes were stored at -‐70 °C.

2.9.4 Denaturing RNA gel

A 2% denaturing RNA gel was prepared by dissolving agarose in MOPS (3-‐(N-‐ morpholino)propanesulfonic acid) buffer and tempering at 56 °C for 30 minutes. 17.5 ml of 34% formaldehyde solution was added to 83 ml of the denaturing RNA gel and mixed thoroughly, before pouring into the gel cast.

10 μg of each RNA sample and biotin-‐labelled RNA ladder was run on the denaturing RNA gel. The volumes of RNA samples and RNA ladder were adjusted to 20 μl with RNAse-‐free water, mixed with 10 μl of RNA sample loading buffer, denatured at 70 °C for 5 minutes and immediately put on ice. 20

μl from each sample was carefully loaded into a well of the denaturing RNA gel. The gel was run for 2 hours and 15 minutes at 100 V in MOPS buffer to ensure sufficient separation of RNA size markers.

1:10,000 in MOPS buffer, in the dark on a rocking platform at 50 rpm for 30 minutes. The quality of RNA was determined by the presence of 16S and 23S rRNA bands, when viewed under UV light.

2.9.5 Capillary blotting

Capillary blotting apparatus was assembled by placing the lid of a medium-‐sized box at a 90° angle on top of the box filled with Transfer buffer. A long strip of standard filter paper was cut and soaked in Transfer buffer, before being placed on top of the lid, with the ends dipped in Transfer buffer. A 25 ml sterile pipette was used to roll across the filter paper to make it flat. The RNA gel was cut with a scalpel to the desired size and placed on top of the filter paper on the lid. A Hybond®_{-‐N+ nitrocellulose membrane (GE Healthcare, UK) was cut slightly}

larger than the gel and floated on the surface of RNase-‐free water for 5 minutes. The membrane was submerged in RNase-‐free water and then soaked for 5 minutes in Transfer buffer, before being placed on top of the gel. Another 25 ml sterile pipette was rolled across to exclude air bubbles. Two pieces of filter paper were cut and placed on top of the membrane, rolling across with a 25 ml sterile pipette each time. Strips of Parafilm M®_{were used to seal the area}

around the gel to prevent the bypassing of the capillary action. A large stack of paper tissues, with a heavy weight on top, was placed on the filter paper. This ensured that RNA would transfer from the gel onto the nitrocellulose membrane due to capillary action. The capillary blotting apparatus was incubated overnight in order to allow complete RNA transfer.

2.9.6 Hybridisation

Following an overnight incubation, the blotting apparatus was disassembled and the nitrocellulose membrane removed from the top of the gel. RNA was fixed to the membrane by UV crosslinking at 120,000 mJ for 2 minutes and then soaked for 10 minutes in Neutralisation solution. Subsequently, the membrane was placed inside a hybridisation tube, with the RNA side facing inwards. 20 ml

of pre-‐warmed pre-‐hybridisation solution was added to the hybridisation tube, which was then placed on rotation in a hybridisation oven for 1 hour at 58 °C (20 °C below the melting temperature of the probe). In the meantime, 900 ng -‐ 1

μg of the RNA probe was mixed with 10 ml of pre-‐warmed pre-‐hybridisation solution, denatured at 65 °C for 15 minutes in a water bath and then immediately placed on ice. After a one-‐hour incubation at 58 °C, the pre-‐ hybridisation solution was discarded from the hybridisation tube. 10 ml of the denatured RNA probe was added to the hybridisation tube with the nitrocellulose membrane, which was then placed on rotation in a hybridisation oven overnight at 58 °C.

2.9.7 Detection of biotin-‐labelled RNA

All wash and detection steps were carried out with the nitrocellulose membrane placed inside a black Incubation box (LI-‐COR, UK). The membrane was washed twice with 50 ml of Wash solution I for 5 minutes. It was then washed three times for 15 minutes with 50 ml of Wash solution II at 58 °C in a water bath. Subsequently, the membrane was washed with 30 ml of Wash buffer for 5 minutes on a rocking platform at 100 rpm and incubated in 15 ml of Odyssey®

Blocking buffer (LI-‐COR, UK) for 30 minutes on a rocking platform at 50 rpm. 1.5 μl of IRDye®_{800CW Streptavidin (LI-‐COR, UK) was added directly to the}

blot submerged in the Odyssey®_{blocking buffer. The membrane was left for a}

further 30 minutes at 50 rpm. Finally, the membrane was washed twice with 30 ml of Wash buffer for 30 minutes. Northern blots were visualized using IR740 Module lighting and LY800 filter, with a ten-‐minute exposure.

In document The application of high throughput sequencing to study the genome composition and transcriptional response of Haemophilus influenzae (Page 67-72)