Plasmid DNAs

2.4.1 Plasmids used in this study.

Several plasmids were used in this study, either directly, as backbone vectors for cloning, or to provide DNA sequences for the construction of new plasmids:

pdl'MCS(C'V5): empty lentivirus vector for expressing proteins with a C- terminal V5-tag. Expression is controlled by the constitutive SFFV (spleen focus forming virus) promoter, which produces a single bicistronic mRNA that encodes for the protein of interest together with a puromycin resistance product for mammalian cell selection (modified from the self-inactivating lentivirus vector pHR-SIN-CSGW by Dr. Yun-Hsiang Chen; see appendix A.1).

pdl'PR8/NS1(C'V5): lentivirus vector expressing C-terminally V5-tagged PR8/NS1; provided by Dr. Yun-Hsiang Chen (Hale et al., 2006).

pdl'PR8/NS1(N'V5): lentivirus vector expressing N-terminally V5-tagged PR8/NS1; provided by Ms. Marian Killip (Hale et al., 2006).

pdl'Vic/NS1(C'V5): lentivirus vector expressing C-terminally V5-tagged Vic/NS1; provided by Dr. Yun-Hsiang Chen (Hale et al., 2006).

pdl'SeV/V(C'V5): lentivirus vector expressing C-terminally V5-tagged SeV/V; provided by Dr. Yun-Hsiang Chen (Hale et al., 2006).

pCMVR8.91: plasmid expressing the gag/pol, tat and rev genes of HIV-1 (used in lentivirus production, provided by Dr. Yun-Hsiang Chen).

2. Materials and Methods

- 76 -

pMD-G: plasmid expressing the vesicular stomatitis virus glycoprotein (VSV-G) gene (used in lentivirus production, provided by Dr. Yun-Hsiang Chen).

pGEX-4T3: used for bacterial expression of GST, and to generate vectors encoding GST-TEV-fusion proteins (Amersham Biosciences Ltd., U.K.).

pHH21-Ud/NS: vector containing the entire NS segment of Ud virus (provided by Prof. Robert A. Lamb, Northwestern University, U.S.A.). Used to amplify Ud/NS1 cDNA for other vectors, as well as to substitute nucleotides encoding the Y89F mutation prior to recombinant Ud virus rescue.

pHH21-WSN/NS: vector containing the entire NS segment of WSN virus (provided by Prof. Robert A. Lamb, Northwestern University, U.S.A.). Used to amplify WSN/NS1 cDNA for other vectors, as well as to substitute nucleotides encoding the Y89F mutation prior to recombinant WSN virus rescue.

pEF.mda-5'c-myc: mammalian expression vector encoding myc-tagged mda-5 (Andrejeva et al., 2004).

pGFP.RIG-I(Heli): mammalian expression vector encoding the GFP-tagged helicase domain of RIG-I (provided by Dr. Friedemann Weber, University of Freiburg, Germany).

pGFP.RIG-I(CARD): mammalian expression vector encoding the GFP-tagged CARD domain of RIG-I (provided by Dr. Friedemann Weber, University of Freiburg, Germany).

pEF'tag: mammalian expression vector derived from pEF-plink2 (provided by Dr. Jelena Andrejeva, University of St. Andrews, U.K.), and used to

express domains of bovine p85β with an N-terminal myc-tag.

pMT2-bov.p85β: used as template to amplify fragments of bovine p85β (provided by Prof. Bart Vanhaesebroeck, Queen Mary, University of London, U.K.).

pEHISTEV: used to generate T7-driven 6His-tagged constructs where the 6His-tag can be removed from the recombinant protein by digestion with TEV protease (provided by Dr. Huanting Lui, University of St. Andrews, U.K.).

pGAD.p110α.ABD: T7-driven expression of the adapter-binding domain of human p110α (provided by Dr. Marie DeFrances, University of Pittsburgh, U.S.A.; Zu et al., 2007).

2.4.2 Plasmids generated in this study.

Several novel plasmids were generated for transfections, the isolation of stable cell- lines, or bacterial expression. The integrity of all new constructs was confirmed by sequencing prior to use (DNA Sequencing Service, Dundee, U.K.):

pdl'WSN/NS1(C'V5): cDNA encoding for the NS1 protein of WSN was amplified by PCR from pHH21-WSN/NS using gene-specific primers. Silent splice acceptor mutations and a silent SmaI site were made by overlap PCR (i.e. pHH21-WSN/NS nucleotides 525-530 were changed from CCAGGA to CCCGGG without altering any amino acids). This prevents the production of NEP mRNA. The resulting PCR product was ligated between the SpeI and NdeI sites of pdl'MCS(C'V5).

pGEX'TEV'PR8/NS1: cDNA encoding for the PR8/NS1 protein was amplified from pdl'PR8/NS1(C'V5) by PCR using gene-specific primers. The forward primer contained a coding region (GAAAACCTGTATTTTCAGGGCGCC) for the cleavage

2. Materials and Methods

- 78 -

sequence of tobacco etch virus (TEV) protease. The digested PCR product was ligated between the EcoRI and NotI sites of pGEX-4T3.

pGEX'TEV'Ud/NS1, pGEX'TEV'Vic/NS1, pGEX'TEV'PR8/NS1Δ72: constructed as for pGEX'TEV'PR8/NS1 using specific templates. The template for Ud/NS1 was pHH21- Ud/NS, therefore the same splice acceptor mutation was generated as for pdl'WSN'NS1(C'V5). The template for Vic/NS1 was pdl'Vic'NS1(C'V5). Primers for pGEX'TEV'PR8/NS1Δ72 were designed to amplify nucleotides encoding amino acid residues 73-230 of PR8/NS1. All forward primers used to construct these plasmids contained nucleotides encoding for the TEV protease cleavage sequence (see above).

pdl'PR8/NS1Δ73(C'V5): nucleotides encoding amino acid residues 74-230 were amplified by PCR from pdl'PR8/NS1(C'V5) and ligated between the SpeI and NdeI sites of pdl'MCS(C'V5).

pdl'β-iSH2(C'V5): nucleotides encoding amino acids 433-610 of bovine p85β were amplified by PCR from pMT2-bov.p85β and ligated between the SpeI and NdeI sites of pdl'MCS(C'V5).

pdl'NLS'β-iSH2(C'V5): nucleotides encoding amino acids 433-610 of bovine p85β were amplified by PCR from pMT2-bov.p85β. The forward primer contained nucleotides encoding for the NLS of SV40 T antigen (namely, MPKKKRKV). The digested fragment was ligated between the SpeI and NdeI sites of pdl'MCS(C'V5).

pHH21-Ud/NS (NS1-Y89F) and pHH21-WSN/NS (NS1-Y89F): A ~900bp fragment of the respective NS segment was amplified by PCR, and digested at the "internal" restriction sites: NcoI and ApaI. The gene-specific forward primer consisted of nucleotides encoding for the Y89F amino acid substitution, and NcoI/ApaI were

unique within the vector. Thus, after excision of the ~900bp NcoI/ApaI fragment from each wild-type vector, the "mutated" fragment was ligated in. Ligated constructs were screened by sequencing. The plasmids were sent to Prof. Robert Lamb (Northwestern University, U.S.A.) in order to rescue recombinant influenza A viruses.

pEF-p85β'myc and pEHISTEV-p85β plasmids: For mammalian expression vectors encoding N-terminally myc-tagged domains of bovine p85β, cDNA fragments corresponding to each domain [SH3 (aa 1-100), nSH2 (aa 313-433), iSH2 (aa 433- 610), and cSH2 (aa 611-724)] were amplified by PCR from pMT2-bov.p85β and ligated between the NcoI and SpeI sites of pEF'tag. For T7-driven 6His-tagged β- iSH2 (aa 433-610), nSH2-iSH2 (aa 313-610), β-iSH2’565 (aa 433-564), and nSH2- iSH2’565 (aa 313-564), the relevant cDNAs were PCR amplified from pMT2- bov.p85β and ligated between the NcoI and NotI sites of pEHISTEV.

pGEX'TEV'β-iSH2(565-610): A cDNA fragment encoding the C-terminal 45 amino acids of the p85β iSH2 domain was amplified by PCR using gene-specific primers and ligated between the NcoI and NotI sites of digested pGEX'TEV'PR8/NS1. The resulting plasmid encodes β-iSH2(565-610) with a GST-tag fused to its N-terminus. The GST-tag can be removed from the fusion protein by digestion with TEV protease.

pEHISTEV'PR8/NS1: 6His-tagged full-length PR8/NS1 was generated by partially digesting pGEX'TEV'PR8/NS1 with NcoI/NotI and ligating the ~700 bp fragment into the corresponding sites of linearised pEHISTEV.

For all plasmids, 4-primer overlap PCR was used to introduce specific site-directed point mutations into a variety of constructs as required (e.g. NS1-Y89F, NS1-M93A, NS1-D92E, NS1-Y89E, NS1-R38AK41A).

2. Materials and Methods

- 80 -