Polymerase Chain Reaction

In order to determine whether leptin receptor and SUMO-1 ribonucleic acid (RNA) was present on human oocytes and pre-implantation embryos, quantitative Real- Time Polymerase Chain Reaction (qRT-PCR) was performed on frozen-thawed oocytes (SUMO-1), zygotes and embryos (SUMO-1 and leptin receptor) at varying developmental stage and quality, obtained 1-7 days post-insemination.

2.18.1 Cell Lysis

The Ambion Single Cell-to-CT™Kit (Life Technologies Ltd, Paisley, UK) Single Cell Lysis Solution, Single Cell DNase 1, and Single Cell Stop Solution were removed from the -20° freezer and thawed for approximately 5 minutes. For each oocyte/embryo, 9µl Single Cell Lysis Solution was mixed with 1µl DNase 1 (Life Technologies) in a sterile 0.5ml flat cap PCR tube (Starlab Group, Milton Keynes, UK). The zona pellucida of each oocyte/embryo was removed by rinsing through Acid Tyrodes Solution (Origio) and ISM1 medium (Origio) with a 135µm denuding pipette (Origio). The zona-free oocytes/embryos were added to the PCR tubes containing

lysis/DNase solution and incubated for 5 minutes at room temperature. The cell lysis reaction was halted by adding 1µl Single Cell Stop Solution (Life Technologies) to each tube and incubated for a further 2 minutes at room temperature. The tubes were stored at -20°C until ready for processing.

2.18.2 RNA Reverse Transcription

The Ambion Single Cell-to-CT™Kit (Life Technologies) Single Cell VILO™RT Mix and the Single Cell SuperScript® RT were removed from the -20°C freezer and kept on ice.

When thawed, 3µl Single Cell VILO™RT Mix (Life Technologies) was added to 1.5µl Single Cell SuperScript® (Life Technologies) per reaction in a sterile 0.5ml flat cap PCR tube (Life Technologies), and centrifuged to ensure all solution was mixed in the bottom of the tube. Each pre-prepared lysed cell sample tube was centrifuged prior to addition of 4.5µl RT reaction mix.

The sample tubes were centrifuged once more before transferring to a pre-heated Hybaid PCR Sprint Thermal Cycler (Thermo Scientific, Ma, USA). Reverse

transcription of RNA to complementary deoxyribonucleic acid (cDNA) was achieved by running a three-step programme. Copying the RNA to produce a strand of cDNA was accomplished by holding the PCR tubes at 25°C for 10 minutes. Extending the copies of the resulting cDNA strand occurred at 42°C for 60 minutes, and the reverse transcriptase was stopped by holding at 85°C for 5minutes. Samples tubes were removed from the thermal cycler, allowed to cool, and kept at -20°C until ready to perform cDNA preamplification.

2.18.3 cDNA Preamplification

In order to preamplify the cDNA prior to performing RT-PCR, lypholised primers for the detection of leptin receptor (Sigma) or SUMO-1 (Sigma) were resuspended in RNase/DNase free sterile water according to the required nanomolar concentration. Thesense primers, sequence 5’CTATGAGGACGAAAGCCAGAG3’ (leptin receptor) and 5’TTTGTAAACCCCGGAGCGA3’ (SUMO-1) were resuspended in 394µl, and the anti- sense primers, sequence5’GACTGAACTATTTATAAGCCCTTGT3’ (leptin receptor) and 5’TTCAACTGAGGACTTGGGGG3’ were resuspended in 404µl. The tubes were

centrifuged to ensure complete mixing, and 2µl of each primer mix per reaction was added to 68µl of pH 8.0 Tris/EDTA buffer (TE buffer) (Applied Biosystems), to

produce a final concentration of 20nmol.

2.18.4 Real-Time PCR

For each reaction, 5µl of Ambion Single Cell PreAmp Mix (Applied Biosystems) was added to 6µl of the prepared primer mix in a sterile 0.5ml flat cap PCR tube (Life Technologies) and centrifuged. Finally, 11µl of the preamplification mixture was added to each cDNA sample. The sample tubes were centrifuged once more before transferring to a pre-heated Hybaid PCR Sprint Thermal Cycler (Thermo Scientific). Preamplification of cDNA was achieved by holding the temperature at 95°C for 10 minutes, then denaturing and extending the cDNA copies at 95°C for 15 seconds and 60°C for 4 minutes respectively. This cycle was repeated 14 times, followed by enzyme deactivation at 99°C for 10 minutes. The preamplified cDNA samples were

diluted 1:2 with RNase/DNase free water in sterile 0.5ml flat cap PCR tubes, centrifuged and stored on ice until ready to proceed with the RT-PCR step. Lypholised primer and double-dye Taqman probe mixture for detection of leptin receptor or SUMO-1 (PrimerDesign Ltd, Southampton, UK) were resuspended in 330µl sterile RNase/DNase free water, then vortexed and centrifuged briefly to ensure complete resuspension. In a sterile 1.5ml flat cap PCR tube, 1µl of the primer/probe mixture was added to 10µl Precision-LR MasterMix and 4µl

RNAse/DNAse free water per reaction. A Micro Amp Fast Optical 96-well Reaction Plate (Applied Biosystems) was prepared by reverse-pipetting 15µl

primer/Mastermix into each well, and adding 5µl 1:10 diluted specific cDNA

solution. Each reaction was performed in triplicate, and negative control wells were included containing only RNase/DNase free water to ensure cross contamination of the wells or sample had not occurred. The plate layout is shown in figure 2.18. For the SUMO-1 run, the plate layout was similar, although wells A1 and B1 contained oocyte cDNA solution, and subsequent wells in column 1 contained zygote stage, cleavage stage and blastocyst stage cDNA solutions.

2PN D2 D3 Blast

RNase/DNase-free water only

Figure 2.18: Layout of 96-well PCR plate for detection of leptin receptor RNA.

Once prepared, Thermal Seal RT2 optically transparent film (Sigma) was sealed around the top of the plate to cover all wells, and the plate centrifuged at 3000rpm for 7 minutes.

Amplification was achieved using an Applied Biosystems 7500 Fast Real Time PCR system (Life Technologies) at standard speed. Enzmye activation was attained by heating the plates at 95°C for 10 minutes, followed by denaturation at 95°C for 15 seconds and fluorogenic data collection at 60°C for 60 seconds. The cycle was repeated 50 times.