Primers used in this study

To clone CAPD2 cDNA into the SmaI site of the pGEX2TK plasmid for later GST- CAPD2 expression, the forward primer: AATGGCTCCCCAAATGTATGAGTTCC, and reverse primer: ATACCCTGCACAGGGAGGAC were used, producing an amplicon of 4,240 bp. To produce the plasmid to express the GST-CTD fusion protein, inverse PCR was performed on the pGEX2TK-CAPD2 plasmid utilising the primers CTTCGGGCCTGTCATACCAG (forward) and TGGGGATCCAACAGATGCAC

37

(reverse), which produced an amplicon of 5,345 bp. Primers were purchased from Integrated DNA Technologies (IDT).

2.2.6 Site-directed mutagenesis

Site-directed mutagenesis (SDM) was performed to create the pET3d-H1.4S27E-FLAG construct from pET3d-H1.4-FLAG, and to correct a point mutation in CAPD2 cDNA from HeLa cells using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer’s instructions. Primers used to attain the H1.4S27E mutation in the pET3d-H1.4-FLAG plasmid were GAAGAAGGCCCGC AAGGAGGCAGGTGCG (forward) and CGCACCTGCCTCCTTGCGGGCCTTCTTC (reverse), with the underlined codon being that changed from serine to alanine. The amplicon produced was 5,343 bp. The primers used for site-directed mutagenesis of CAPD2 cDNA from HeLa cells that had been cloned into the pGEX2TK plasmid were GCCTCAAAGAAGATACTCTGCAATTCCTGATAAAAGTGGTA (forward) and TACCACTTTTATCAGGAATTGCAGAGTATCTTCTTTGAGGC (reverse). The underlined codon indicates the point mutation corrected from glutamate to glutamine at position 83, the amplicon was 9,209 bp. Primers were purchased from IDT.

2.2.7 Cloning

Restriction endonuclease digestions were performed according to the manufacturer’s instructions. The QIAquick PCR Purification Kit (Qiagen) was used to purify the digested plasmid or insert. Products were analysed by agarose gel electrophoresis (Section 2.2.2) to verify whether digestion was complete. Phosphate groups were removed from vector ends using rAPid Alkaline Phosphatase (Roche), phosphate groups were added to the PCR products where required using T4 Polynucleotide Kinase (Thermo Fisher Scientific), and ligations were carried out using T4 DNA Ligase (Thermo Fisher Scientific) according to the manufacturer’s instructions.

38

2.2.8 Transformation of competent Escherichia coli cells

Up to 100 ng of ligation reactions or plasmid DNA (Table 2.1) were added to 50 μL of the indicated competent E. coli strains. DH5α cells (Thermo Fisher Scientific) or JM110 cells (kindly supplied by Dr Jeong Park; Massey University) were used for plasmid amplification, and BL21 or BL21(DE3) cells (Agilent Technologies) were used for protein expression. Cells were incubated on ice for 30 minutes followed by heat shock at 42 °C for 45 seconds, incubation on ice for 2 minutes followed by the addition of 500

μL of sterile S.O.C Medium (Thermo Fisher Scientific). The cells were incubated at 37 °C for 1 hour with shaking at 225 rpm. The cell suspension (50 μL) was plated on LB (lysogeny broth) agar plates which contained ampicillin (100 μg/mL); if necessary the cells were concentrated by centrifugation at 5,000 rpm for 5 minutes and cells were resuspended and plated after removal of 450 μL of supernatant. The plates were incubated overnight at 37 °C, and then stored at 4 °C.

2.2.9 Plasmid purification

Following transformation (Section 2.2.8) and bacterial culture in LB medium, plasmids were extracted using the ChargeSwitch Pro Plasmid MiniPrep Kit (Thermo Fisher Scientific) for screening of clones via restriction endonuclease digestion. Once DNA sequencing (Section 2.2.10) confirmed that the plasmid of the correct identity was attained the PureLink HiPure Plasmid Filter Midiprep Kit (Thermo Fisher Scientific) was used to obtain high quality plasmid DNA.

2.2.10 DNA sequencing

Sanger sequencing of DNA was performed at the Massey Genome Service (MGS, Massey University, Palmerston North), using the BigDye™ Terminator Version 3.1 Ready Reaction Cycle Sequencing Kit (Thermo Fisher Scientific) on the ABI3730 DNA Analyzer using specific sequencing primers. Sequencing reactions contained 600 ng of plasmid DNA and 4 pmol of primer in 20 μL.

39

2.1. Plasmids used in this study

Plasmid Manufacturer Expression

system

Plasmid Source

pTRE-Tight-H1.4-FLAG Clontech HeLa Tet-On CRG laboratory pTRE-Tight-H1.4S27A-FLAG Clontech HeLa Tet-On CRG laboratory pTRE-Tight-H1.4S27E-FLAG Clontech HeLa Tet-On CRG laboratory pET-3d-H1.4-FLAG Merck Millipore BL21(DE3) CRG laboratory pET-3d-H1.4S27A-FLAG Merck Millipore BL21 (DE3) CRG laboratory pET-3d-H1.4S27E-FLAG Merck Millipore BL21 (DE3) This study pET-3d-H1.4K26A-FLAG Merck Millipore BL21 (DE3) CRG laboratory pET-3d-H1.4/H1.2-FLAG Merck Millipore BL21 (DE3) Dr Nicole Happel,

University of Göttinggen pET-3d-A1.5-FLAG Merck Millipore BL21 (DE3) CRG laboratory pET-3d-A2345-FLAG Merck Millipore BL21 (DE3) CRG laboratory pET-3d-E1.5-FLAG Merck Millipore BL21 (DE3) CRG laboratory pGEX-2T GE Healthcare BL21 GE Healthcare pGEX-2T-HP1β GE Healthcare BL21 CRG laboratory pGEX-2TK GE Healthcare BL21 GE Healthcare pGEX-2TK-CAPD2 GE Healthcare BL21 This study pGEX-2TK-CTD GE Healthcare BL21 This study

40

2.3 Protein manipulations

Protein samples were kept at 4 °C at all times during manipulation to protect their integrity. In addition all solutions and buffers for cell lysis or protein storage had cOmplete™ or cOmplete™ ULTRA Mini Protease Inhibitor Cocktail Tablets containing EDTA (Roche) added according to the manufacturer’s instructions. The phosphatase inhibitor sodium fluoride (NaF) was added to a final concentration of 1 mM where phosphorylation was being investigated.

2.3.1 Protein quantification

Purified proteins or lysates were quantified in duplicate using the bicinchoninic acid (BCA) microplate assay (Pierce). Protein was quantified using standards of known concentration prepared from bovine serum albumin (BSA; Thermo Fisher Scientific), or in the case of purified histones, calf thymus H1 (Sigma). Protein standards were prepared with the buffer used for lysis. In instances where the quantification of protein was not suitable cells were counted using a haemocytometer and equal cell concentrations were used.

2.3.2 SDS-PAGE

For protein electrophoresis using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), equivalent amounts of protein were set up in equal volumes of 1 x Laemmli buffer (62.5 mM Tris pH 6.8, 7.5% glycerol, 1.67% SDS, 0.0025% bromophenol blue, 35.75 mM β-mercaptoethanol; Laemmli, 1970) and were boiled for 5 minutes. Samples were subject to discontinuous gel electrophoresis through a 5% stacking gel before resolution in a 12% gel (Davis, 1964; Ornstein, 1964) in 1 x Tris-glycine-SDS running buffer (TGS; 25 mM Tris, 192 mM glycine, 1% SDS) at 100 V for 2 – 3 hours. Where required, gels were stained with 0.1% Coomassie blue R-

41

350 (PlusOne Coomassie PhastGel® Blue R-350 tablets; Sigma) in 30% methanol and 10% acetic acid. Gels were destained in 10% methanol and 10% acetic acid.