qRT-PCR

78

2.5.1.1 Reverse transcription polymerase chain reaction (RT-PCR)

PCR hoods were routinely cleaned with 70% ethanol and subjected to 30 minutes UV light treatment before commencing. RNAseZap® (Sigma-Aldrich Company Ltd, Dorset, UK) was also used to spray the working area and any equipment being used when handling RNA.

RNA extracts from clonal cell lines were subjected to RT-PCR within a designated area of the laboratory. RT-PCR was performed to obtain complimentary DNA (cDNA) using reagents provided in SuperScript III Reverse Transcriptase kit (Invitrogen, Paisley, UK) and random hexamer primers (Invitrogen, Paisley, UK), as shown in Table 2.9.

Group A reagents were added to a microcentrifuge tube, heated at 65 oC for 5 minutes, and incubated on ice for 1 minute. An RT positive (RT+) and negative (RT-) mastermix (MM) was prepared using ‘group B’ reagents; each sample was prepared in duplicate using reverse transcriptase (RT+) and RNase free water (RT-) as an internal control for assessing the success of RT-PCR. ‘group B’ were combined with ’group A’ on ice and mixed by repeat pipetting. Samples were incubated for 5 minutes at 25 o_{C, 60 minutes at 50} o_{C, and 15 minutes at 70} o_C

79

Group Reagent (n=1)

A RNA sample (0.5 µg)

1 µl random primers (200 ng) 1 µl dNTP mix (10 mM) Sterile distilled water to 13 µl B 4 µl 5x first strand buffer

1 µl DTT (dithiothreitol) (0.1 M) 1 µl RNAse-out

*1 µl SuperScript III reverse transcriptase **1 µl RNase free water

Table 2.9. Reagents (Group A and B) used to prepare RT mastermix

Group A reagents were used for the initial RT step and group B reagents used in the latter step. *Superscript III reverse transcriptase was used in Group B reagents for preparing RT+ mastermix. ** RNase free water was used in Group B reagents for preparing RT- mastermix.

80

using a thermocycler. The resulting cDNA was stored at -20 oC for future reference or prepared immediately for real time quantitative PCR, as described in the following section.

2.5.1.2 Real-time quantitative PCR

The resulting cDNA was diluted 1:10 using PCR grade water. A HPV+ control sample was prepared using CaSki cell line DNA diluted to 1:100 using PCR grade water, and a PCR negative control sample prepared using PCR grade water.

LightCycler® Capillaries were placed in LightCycler® Centrifuge Adapters within the LightCycler® aluminium cooling block (all from Roche Applied Science, Mannheim, Germany) in numerical order; the cooling block was stored at 4 oC several hours before commencing the protocol.

The MM was prepared using FS DNA Master SYBR Green reagents (Roche Applied Science, Mannheim, Germany) and HPV specific primers or house-keeping gene primers, as illustrated in Table 2.10; details of forward and reverse primer sets are shown in Table 2.11.

LightCycler® capillaries were supported in their adapters within the chilled cooling block, and 18 µL MM and 2 µl cDNA dispensed into each capillary. Capillaries within their adapters were centrifuged for 3 seconds at 5k rpm to deposit the sample, and then returned to the cooling block in numerical order. Capillaries were taken out of adapters and stored in numerical order within a capillary holder and transferred to a separate laboratory to perform qPCR using LightCycler® quantitative real-time PCR Carousel-Based System and associated PC software. Capillaries were loaded into the carousel of the LightCycler® qPCR machine, and pressed down lightly to ensure they were fully seated. The lid was lowered gently and the specific programme selected using LightCycler® PC software; programme details for PCR amplification cycles were set according to the primer set being used (Table 2.12).

81

Primer pair

E2 _{E4 E5} E6 E7 HPRT TBP2

Reagent µl per reaction

F primer (5 µM) 2 2 2 2 2 2 2 R primer (5 µM) 2 2 2 2 2 2 2 *FS mix 2 2 2 2 2 2 2 MgCl2 (25 mM) 2 1.6 1.2 1.6 2 1.6 2.4 H20 10 10.4 10.8 10.4 10 10.4 9.6 Template cDNA 2 2 2 2 2 2 2 Total volume 20 20 20 20 20 20 20

Table 2.10. Reagents used to prepare mastermixes of each primer set for real-time qPCR *FS mix was produced by adding 10 µl of reagent 1a to a full vial of defrosted reagent Ib; FS was stored at 4 oC within an opaque storage container for up to 1 month, according to the manufacturer’s instructions.

82

Primer set details Name Forward primer Reverse primer Amplified DNA Amplified RNA Reference

Hypoxanthine guanine phosphoribosyl transferase (HPRT) TGACACTGGCAAAACAATGCA

GGTCCTTTTCACCAGCAAGCT

4982 bp (nt 133627546-133632438 of Chromosome X) 94 bp (nt 496-589 of M31642.1)

(Allen et al., 2008)

Name TATA binding protein, 2nd pair of primers (TBP2) Forward primer TCAAACCCAGAATTGTTCTCCTTAT

Reverse primer CCTGAATCCCTTTAGAATAGGGTAGA

Amplified DNA 803 bp (nt 170880539-170881341 of Chromosome 6) Amplified RNA 122 bp (nt 1128-1224 of M55654.1)

Reference (Minner and Poumay, 2009) Name

Forward primer

E6

CTGCAATGTTTCAGGACCCA Reverse primer TCATGTATAGTTGTTTGCAGCTCTGT Amplified DNA/RNA 80 bp (nt 99-178 of NC001526.1) Reference (Wang-Johanning et al., 2002) Name

Forward primer

E7

AAGTGTGACTCTACGCTTCGGTT Reverse primer GCCCATTAACAGGTCTTCCAAA Amplified DNA/RNA 78 bp (nt 739-816 of NC001526.1) Reference (Wang-Johanning et al., 2002) Name

Forward primer

E4

AACGAAGTATCCTCTCCTGAAATTATTAG Reverse primer CCAAGGCGACGGCTTTG

Amplified DNA/RNA 82 bp (nt 3362-3426 of NC001526.1) Reference (Roberts et al., 2008)

83

Forward primer

E2

TAACTGCACCAACAGGATGT Reverse primer TTGCATATGTCTCCATCAAACTGC Amplified DNA/RNA 82 bp (nt 3362-3426 of NC001526.1) Reference Designed in-house

Name

Forward primer

E5

CCGCTGCTTTTGTCTGTGTC Reverse primer GCAGAGGCTGCTGTTATCCA

Amplified DNA/RNA 82 bp (nt 3362-3426 of NC001526.1) Reference Designed in-house

Table 2.11. Details of qPCR primer sets used and gene products amplified

M31642.1 = GenBank accession no. Homo sapiens HPRT mRNA. M55654.1 = GenBank accession no. Homo sapiens TBP2 mRNA. NC001526.1 = GenBank accession no.: HPV 16.

Temperature (°C) Time (s) Cycles

Initial denaturation 95 600 1

Denaturation 95 10

Primer annealing 58/60/62* 5 60

Extension 72 5

Temperature (°C) Rate of change (°C/s) Cycles

Melting curve 65-95 0.1 1

Table 2.12. Details of qPCR conditions for each primer set .

Details are provided for both the qPCR reaction and the melting curve. *Annealing temperatures were primer pair specific. E5/E4 (58 °C), E2/E6/HPRT/TBP (60 °C) and E7 (62 °C).

84

Relative expression of HPV genes was determined by quantifying clonal cell line cDNA using LightCycler® software and analysing data through qbasePLUS (Biogazelle Zwijnaarde, Belgium) according to the manufacturer’s instructions, and documented in the literature (Hellemans et al., 2007); absolute quantification of HPV gene expression was not performed. Data manipulation and analysis was carried out using qbasePLUS because this function was limited in LightCycler® software.

Real-time PCR using LightCycler® system provided a Ct value (cycle threshold) translating to the number of cycles required for fluorescent signal to accumulate to a level where it intersects with the threshold (exceeds the background signal). Thresholds were calculated automatically in the LightCycler® software using second derivative maximum.

HPV genes and cellular house-keeping gene concentrations were imported in to qbasePLUS software and used to calculate the ratio between HPV genes and cellular housekeeping genes to establish relative gene quantifications within each sample. Expression ratios were calculated using CaSki as a calibrator sample, such that expression ratios are expressed relative to CaSki RNA.