Quantification of CpG methylation levels in UCHL1 by Pyrosequencing:

Pyrosequencing was used to quantify methylation of UCHL1 that has been methylated obtained from the CpG array data via collaboration with Professor

Reverse Primer Forward Primer gene name TAATCCACCTTGGTCGGAAG AAGCGGAAATGTGAAAATGG PPIA-CHIP AAAGGCATTCGTCCATCAAG GTCCCCTGAAGACAGAGGAA UCHL1-CHIP

Brown, Chair in Translational Oncology in the Department of Surgery and Oncology at Imperial College. The array has been perfomed on the isogenic ovarian cancer cell lines using two CpG for a number of genes. UCHL1 was among the genes tetsed and was found to be methylated at (Position 40953551) in PEO1 and PEO4 cells. This position contains CpG islands and was shown to be methylated in the DNA methylation arrays. Genomic DNA was collected after HDAC4 knockdown in PEO1 and PEO4 cell lines (untransfected, lamin transfected and HDAC4 transfected) and extracted according to the manufacturer's instructions using Qiagen DNA Mini-kit

2.16 .1 Bisulphite Conversion of DNA:

DNA was bisulfite treated using the EpiTect Bisulfite Kit (Qiagen) according to manufacturer's instructions. Briefly, 1 μg of PEO1, PEO4 cell lines and control DNA (unmethylated and in vitro methylated DNA) genomic DNA was diluted in water to a final volume of 20 μl was combined with 85 μl of Bisulfite mix and 35 μl of DNA protect buffer. The bisulfite DNA conversion was performed using the following conditions; denaturation for 5 minutes at 99°C, incubation for 25 minutes at 60°C, denaturation for 5 minutes at 99°C, incubation for 85 min at 60°C, denaturation for 5 minutes at 99°C, incubation for 175 minutes at 60°C, final hold at 20°C. The bisulfite converted DNA was purified following manufacturer's instructions the DNA Purification kit (Qiagen). In brief, the bisulfite reaction was mixed with 560 μl of Buffer BL, applied to the spin column and centrifuged at 12,000 rpm for 1 minute. The flow through was discarded and the column was washed with 500 μl of Buffer BW. 500 μl of Buffer BD was applied to the column and incubated at room temperature for 15 minutes. The column was centrifuged to get rid of Buffer BD and then washed twice with 500 μl of Buffer BW. Residual BW buffer was removed by an additional spin at 12,000 rpm for 1 minutes. 20 μl of Buffer EB was added to the column to elute the DNA. The DNA concentration was determined using a Nano-drop spectrophotometer.

2.16 .2 Pyrosequencing:

All biotinylated primers were designed using Pyromark Assay Design version 2.0.1.15 (Qiagen), are HPLC-purified. PCR was carried out in a 25 μl volume containing 1 µl of all the bisulfite treated DNA samples (control in vitro methylated DNA, normal DNA, PEO4 and PEO1 cell lines after transfection with HDAC4 and lamin), 1µg/µl of pyrosequencing primers, 0.5 μl of 10 mM dNTP mix, 2.5 μl of 10 x PCR buffer, 7 μl of 50 mM MgCl2, 0.2 μl of fastTaq DNA polymerase and sterile H2O up to a final volume of 25 μl. Amplification was performed for cycling were 95°C for 5 minutes, followed by 45 cycles of 95°C for 15 sec, 55°C for 30 sec and 72°C for 15 sec, then extension step at 72°C for 5 minutes. The specificity of the primers was checked on 1% agarose gel stained with ethidium bromide in order to see the precise bands. the Biotin-labelled PCR product were immobilized on Streptavidin-coated Sepharose beads by mixing 15 µl of a PCR product with 6 µl Streptavidin Sepharose suspension, 10 µl water and 40 µl Binding Buffer (26; 10 mmol/L Tris-HCl, 1 mmol/L EDTA, 2 mol/L NaCl, 1 mL/L Tween 20, pH 7.6) in a PSQ 96-well reaction plate followed by shaking at room temperature for 5 minutes for preparation to single-stranded DNA template to act as a template in a pyrosequencing reaction. The Pyrosequencing Vacuum Prep Workstation that consists of a hand-held Vacuum Prep Tool with 96-filter probes was used to transfer the biotinylated PCR products onto the filter probes after applying the vacuum and then washed with 70% ethanol for 15 sec, denaturation solution (0.2 M NaOH) for 15 sec and washing buffer (10mM Tris- acetate pH 7.6) for 15 sec. The vacuum was removed to release beads from the filter and biotinylated ssDNA templates were resuspended in 12 mL annealing buffer (20 mmol/LTris-acetate, 2 mmol/L Mg Ac2) containing 0.3 mM sequencing primer in the wells of a PSQ-HS 96 plate (Biotage). The mixture was heated at 90°C for 2 minutes and then cooled to room temperature to allow the annealing of the Pyrosequencing primers to the templates. The plate was analyzed using PyroMark MD Pyrosequencer (Biotage), after which methylation values were quantified using by the Pyro Q-CpG Software v1.0.9 (Biotage).

Figure 17: The pyrosequencing assay starts with bisulfite treatment to the DNA samples that converts nonmethylated cytosines to uracils, whereas methylated cytosines are resistant for the conversion. PCR amplification will follow using biotinylated primer. The tagged biotinylated primer incorporated into the amplicon sequence and anneal to the complementary sequence which will result in labelled amplicons with biotin. The biotin- labelled amplicons will capture by binding to streptavidin-coated Sepharose beads. Then the DNA will be denaturing to produce single strand DNA template. The sequencing

DNA. Finally, the pyro-sequencing apparatus will detect every nucleotide in the template DNA in order as they will be distinguished with different lights seen as a peak in the pyrosequencing program. This will quantify C for methylated and T for unmethylated and give an estimate of the methylation level in the sample.

sequence primer GGGGGAGTAGGGGTAGAATTA Sequencing 1 CCACAACCACCAAATTATCTC Sequencing 2 GGAGTAGGGGTAGAATTAA Forward GTTAGATGGGTAAGAATTT Biotylated reverse

Table 6: Pyrosequencing primers for UCHL1; forward, biotin-labelled reverse and two sequencing for UCHL1 gene; Probe cg24715245 and Position 40953551. In CpG islands that are densely populated by CpG sites, it is difficult to quantify consecutive CpG sites with one sequencing primer. Therefore, 2 sequencing primers were design to quantify all the CpG sites in the region.