Reverse transcriptase polymerase chain reaction(RT-PCR)

11.2.9.(1). RNA extraction

(i)Total RNA preparation from rat tissues

Tissues were snap frozen in liquid nitrogen immediately after dissection. 100 mg of tissue was ground in liquid nitrogen using a pestle and mortar and then homogenised using a polytron probe(Ultra turrax T25, Jank & Kunkel IKA Labrotechnik) in 1 ml of a solution containing 4 M guanidinium isothiocyanate, 25pM Sodium Acetate pH 5.2 and 14%v/v p-mercaptoethanol. A cushion of 220 pi solution (containing 5.7 M CsClj, 0.1 M EDTA pH 7.5 and 0.1% DEPC) was placed on the bottom of a Beckman SW40 polyallomer tube and the tissue extract was layered on it. The samples were then spun in a Beckman TL- 100 ultracentrifuge at 55,000rpm for 3 hours at 18°C and the RNA was pelleted at the bottom of the tube. The supernatant was decanted. The RNA pellet was resuspended in 100 pi DEPC treated H2O. The RNA was precipitated with 2.5 volumes o f ethanol and 0.1 volume of 3M sodium acetate at -70°C for 1 hour then spun at 13,500 rpm for 15 mins at 4°C. The RNA was washed in 70% ethanol, freeze dried and then resuspended in DEPC treated HjO.

(ii)RNA preparation from cells using RNAzol™B solution

washed in PBS and harvested in the RNAzol™B solution(0.2 ml per 1X10^ cells). 200 |il chloroform was added to the cells. The samples were shaken vigorously before leaving on ice for 5 mins and then centrifuged at 12,000 g at 4oC for 15 mins. The upper aqueous phase was transferred to a fresh tube and equal volumes of isopropanol was added to precipitate RNA. After centrifugation at 12,000 g at 4°C for 15 mins, the RNA was then washed with 70% ethanol, freeze-dried and resuspended in DEPC treated H2O.

11.2.9.(2). DNAse 1 treatment of RNA samples

A 100 pi reaction contained 20 pi of 5x DNAse 1 buffer(50 mM Tris HCl pH 7.6, 10 mM MgCl2, 0.1 mM DTT), 10 units of DNAse free-RNAse inhibitor, 1 pg o f RNAse-free DNAse 1 enzyme and 2 pg of RNA. This reaction was incubated at 37oC for 30 minutes. To stop the reaction and remove the enzyme, Ix Phenol/chloroform extraction was performed followed by Ix chloroform extraction. The RNA was precipitated by 2.5 volumes of ethanol and 0.1 volume of 3 M sodium acetate.

11.2.9.(3). cDNA synthesis from total cellular RNA

1 pg RNA dissolved in H 20 was heated at 65°C for 2 minutes then placed on ice prior to cDNA synthesis in order to destroy the secondary structure of the RNA. A 50 pi cDNA synthesis reaction contained 10 pi of 5x Reverse transcription buffer(50 mM Tris HCl pH 7.6,60 mM KCl, 10 mM MgCl2,lmM DTT), 40 units of RNAse Inhibitor, 10 mM of each

dNTP, 0.5 pg of oligo dT„ 200 units of reverse transcriptase and 1 pg of RNA. The reaction was incubated at 37 °C for 50 mins.

11.2.9.(4). Semi-quantitative RT-PCR

All PCRs were carried out in 100 pi reaction containing cDNA synthesised from cellular RNA, 10 pi oflOx PCR buffer(100mM Tris.Cl pH8.3, 500mM KCl, 15 mM MgCl2 and 0.01%(w/v) gelatin), 200 pM of each dNTP, 0.1 pM of each of upstream and downstream

oligonucleotide primers and 2.5 units of Taq DNA polymerase. Mineral oil was layered on top of reaction to prevent evaporation. Transcripts were amplified in the Hybaid thermal cycler.

Each set o f cDNA synthesised from total cellular RNA was tested by trial PCR using primers to the control cyclophilin mRNA. Since this mRNA is expressed at similar levels in all cell types(Cavicchioli et al., 1995) it can be used to control for any differences between different samples in the amount of RNA added and the efficiency of cDNA production. The primers were 5TTGGGTCGCGTCTGCTTCGA3' and 5'GCCAGGACCTGTATGCTTCTTCA3'. Amplifications were carried out at 94°C(30 s), 58°C(30 s) and 72°C(30 s) and yielded the expected 230 bp product. Amplified products taken at different cycles indicated the efficiency of the cDNA synthesis and also allowed an estimate of the variation of cDNA between samples when resolved on agrose gels. The products were then transferred to membrane filters by Southern blotting and hybridized with the labelled probe. Quantifying the differences between samples allowed to equalize the amount of cDNA used for amplification of the target mRNA i.e. Bm-3a, Bm-3b isoforms.

For each set of BRN-3 PCR carried out, the same volume of cDNA was used in parallel amplification of the control cyclophilin mRNA. Aliquots of the PCR products were taken at different cycles to ensure that the reaction was in the exponential phase. To confirm the identity and facilitate quantification, the amplified products were resolved on 2% agarose gel, transferred to nitrocellulose filter by Southern blotting and hybridized with the specific labelled probes of Bm-3a and Bm-3b. The amplified products were quantified by scanning the autoradiograph using a densitometer. Any variation in the amplification o f the control samples was used to correct the values obtained for the Bm-3 mRNA amplification

The primers designated 3AL, 3AS, 3BL and 3BS were designed from the specific 5' region of Bm-3 A long form, Bm-3 A short form, Bm-3B long form and Bm-3B short form

respectively. The primers designated 3Acorn and 3Bcom were designed from the 5'- coding homologous region o f Bm-3 A isoforms and Bm-3B isoforms respectively. The sequences of these primers are listed below:

3AL 5'GGATTTTTACATGCCAAGGCG3'. 3 AS 5TGGTTTGGTTTGTGTCGCCTG3' 3Acom 5CGCGAGCGACGGCGACGAAT3' 3BL 5'CCGGAGAGAGCGCTCACAATTCC3' 3BS 5GGCTCGGAGGCGATGCGGAGAGC3' 3Bcom 5'GTGGTAAGTGGCGTCCGGCTTG3'

PCR reactions were carried out as described above. Amplification cycles for the mRNAs encoding the two isoforms of Bm-3a were carried out at 94°C(30 s), 57°C(30 s), and 72°C(45 s) and yielded the expected PCR products of 280(short form) or 404(long form) base pairs. Amplification cycles for the mRNAs encoding the two isoforms o f Bm-3b were carried out at 94°C(30 s), 68°C(30 s), and 72°C(30 s) and yielded the expected PCR products of 180(long form) or 203(short form) base pairs.