• No results found

Sample preparation from infected mouse livers:

Sonicated 22 6 □ Sonicated

8.1. Materials:

8.2.4. Sample preparation from infected mouse livers:

The frozen mice were removed from the freezer an hour before the experiment and left at room temperature in a safety cabinet to thaw. Several pieces were cut from different parts of the liver using a sterile blade and transferred to several eppendorf tubes. The tubes were kept on ice.

For DNA extraction the following steps of the protocol of Flowgen Instruments Ltd. were used:

a. Cell lysis:

A 1.5 ml screw cap eppendorf containing 600jil of cell lysis solution was chilled on ice (the solution turned cloudy when cold). Approximately 10-20mg of tissue was added to the tube which was removed from the ice and the contents were homogenised quickly in a Griffith tube. The homogenised tissue was then incubated at lOO^C for 5 minutes to lyse the bacteria. Proteinase K solution (3jil of 20mg/ml)

was added to the tissue and incubated at 55®C in a waterbath for a time varying from 3 hours to overnight.

b. RNase treatment:

The sample was removed from the water-bath and 3|il of RNase A solution was added. The sample was mixed by gently inverting the tube 25 times and it was then incubated at 37^C for 15-60 minutes.

c. Protein precipitation:

The sample was cooled to room temperature and 200pl of protein precipitation solution was added. It was then vortexed at high speed for 20 seconds to mix the solution and tissue. The sample was next centrifuged at ll,0 0 0 g for 3 minutes giving a tight pellet of precipitated proteins.

d. DNA extraction:

The supernatant containing DNA was transferred to another 1.5 ml eppendorf tube containing 600pl isopropanol and mixed gently by inverting the tube 50 times until the white threads of DNA formed a visible clump. The sample was then centrifuged at ll,000g for 1 minute to precipitate DNA as a visible small white pellet. The

removed carefully and the tube drained on clean absorbent paper and allowed to air dry for 10-15 minutes.

e. DNA hydration;

lOOpl of DNA hydration solution was added to the dry pellet which was allowed to rehydrate overnight at room temperature or alternatively it was heated at 65®C for 1 hour (according to protocol the concentration will be lOOjig/ml if the total yield is 10|ig DNA). The DNA extract was stored at 4^C before use.

8.2.5. A m plification:

The composition of the PCR mixture was:

50 mM KCL, 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 0.1% gelatin, O.SpM of each primer, 200 pM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP, and dTTP), 1.25 units of Taq polymerase and 5 pi of DNA template. Besides, glycerol was added as 20% to distilled water for a better yield.

Based on the above mentioned composition the PCR mix (50 pi) was prepared as follows:

Dist. water + 20% glycerol 32 pi

PCR buffer 5 pi primer 1 2 pi primer 2 2 pi dNTPs 1 pi each (total 4pl) Taq polymerase 0.25 pi template 5 pi

The genus-specific primers which were used were: T b ll ( 5 -ACCAACGATGGTGTGTCCAT) and

T bl2 (5’-CTTGTCGAACCGCATACCCT). These primers amplify a 439-bp fragment between positions 398 and 836 of the published gene sequence (Shinnick, 1987).

After preparation, the PCR mixture (without adding the template) was dispensed in small PCR tubes (45 pi in each) and then the templates were added to each tube. The reaction mixture was immediately covered with a drop of mineral oil to avoid evaporation during the amplification steps.

The amplification originally was the same as described by Telenti et al. (1993) using a thermal cycler with 45 cycles of dénaturation for 1 min at 94®C, annealing for 1 min at 60^C and extension for 1 min at 72®C, followed by 10 min of extension at 72®C. The program was then changed to the following which gave a better yield.

Dénaturation Annealing Extension temp: 94®C temp: 60®C temp: 72®C time: 1 min time: 2 min time: 2 min } 1 cycle

When the program was completed, tubes were taken from the thermal cycler and the mineral oil was removed carefully from the surface of the samples using a pipetter with small disposable tips. The agarose gel was prepared and poured into the apparatus to set. The comb was positioned, so that the complete wells were formed when the agarose was set. The gel was about 3-5 mm thick and it normally took 30 to 45 minutes to set at room temperature. After the gel had set, the comb was removed and the apparatus was put into the electrophoresis tank which was filled with sufficient electrophoresis buffer to cover the gel. A small amount (1-2 pi) of gel loading buffer was added to 5 pi of each product, and the slots of the gel were loaded with 6 pi of each mixture using disposable micropipettes. The lid of the tank was replaced and the loaded product was electrophoresed at 10 volts/cm for 45 mins or until the bromophenol blue had migrated the appropriate distance through the gel. Lambda EcoR Hind III marker was used as a molecular size standard.

After the electrophoresis was complete, the gel was removed from the tank and examined under ultraviolet light. The DNA products, which were stained by ethidium bromide (included in the agarose gel and electrophoresis buffer), were then visible. The gel was photographed and observed for the presence of bands of the appropriate molecular size.

FiG .12

Position of T b ll and Tbl2 used as genus specific primers in nucleotide sequence of M. tuberculosis 65kDa heat shock protein gene (Shinnick, 1987).

5 ’ T b l l

ACCAACGATGGTGTGTCCATCGCCAAGGAGATCGAGCTGGAG TGGTTGCTACCACACAGGTAGCGGTTCCT CTAGCTCGACCTC 398

GATCCGTACGAGAAGATCGGCGCCGAGCTGGTCAAAGAGGTA CTAGGCATGCTCTT CTAGCCGCGGCTCGACCAGTTT CTCCAT

GCCAAGAAGACCGATGACGTCGCCGGTGACGGCACCACGACG CGGTTCTT CTGGCTACTGCAGCGGCCA CTGCCGTGGTGCTGC GCCACCGTGCTGGCCCAGGCGTTGGTTCGCGAGGGCCTGCGCA CGGTGGCACGACCGGGTCCGCAACCAAGCGCTCCCGGACGCGT ACGTCGCGGCCGGCGCCAACCCGCTCGGTCTCAAACGCGGCA TGCAGCGCCGGCCGCGGTTGGGCGAGCCAGAGTTTGCGCCGT TCGAAAAGGCCGTGGAGAAGGTCACCGAGACCCTGCTCAAGG

FIG.12 (continue)

CAGCGATTTCGGCGGGTGACCAGTCCATCGGTGACCTGATCGC GTCGCTAAAGCCGCCCACTGGTCAGGTAGCCACTGGACTAGCG

CGAGGCGATGGACAAGGTGGGCAACGAGGGCGTCATCACCGT GCTCCGCTACCTG TTCCACCCG TTGCT CCCGCAGTAGTGGCA

CGAGGAGTCCAACACCTTTGGGCTGCAGCTCGAGCTCACCGAG GCTCCTCAGGTTGTGGAAACCCGACGTCGAGCTCGAGTGGCTÇ

GGTATGCGGTTCGACAAG 3’ CCATACGCCAAGCTGTTC 5’

Related documents