Materials & Methods
CGATGCAGTGCTTCCCAGAA
2.4.5.3 Transformation of competent E, col
DH5a competent cells were supplied by Invitrogen or Gibco BRL or made in-
house, and were transformed exactly according to the manufacturer's recommended
protocol with satisfactorily reproducible results. The transformation itself was tested by
the inclusion of a closed circular plasmid control and a medium-only negative control.
Aliquots of the recovered transformed E. coli were plated out and grown at 37 °C
overnight.
2 . 4 . 5 . 4 Growth media and selection of recombinants
LB broth plus agar (bacteriological, I5g/1), or MacConkey Agar ( see section
2.9.3) plates were used for the growth of all bacterial strains.
Antibiotic selection of transformants was achieved with 50 pg/ml Ampicillin
(pCR™ Vector, pCR™II, pGEM-T), 50 p.g/ml Kanamycin (pCRlOOO, pCR™n), or a
combination of 50 pg/ml of both (pCR™II). 50 |Lig/ml Ampicillin and 15 pg/ml
Tetracycline were required with pTTBlue T-vector and the pTAg vector. In general,
very few or no satellite colonies were observed when Kanamycin was used whether
singly, or in combination with Ampicillin.
Blue/white colour selection of transformants/recombinants by the process of a-
complementation was achieved by spreading 20 jil of X-gal (40 mg/ml in
dimethylformamide) on to the surface of LB agar plates and allowing the solvent to
evaporate about an hour before plating out the transformation reaction. IPTG was not
required since DH5a cells do not contain a functional lad gene and therefore the lac
operon does not need to be induced.
Occasionally, growth on MacConkey Agar plates was performed. Selection
was achieved by differentiating lightly pigmented colonies, possessing inserts, from
darkly pigmented ones.
2 . 4 . 5 . 5 Screening recombinant E. coli for inserts
Two methods were used to screen white colonies from the selection plates, (i)
restriction endonuclease digestion and (ii) colony PCR.
(i) 2-5|il of plasmid DNA from each clone, depending on the mini-prep yield,
was digested with a restriction endonuclease or combination thereof, designed to release
the insert from the multiple cloning site. Conditions were according to manufacturer's
recommendations (see section 3.3). Reactions were fractionated and visualised on
agarose gels (section 2.3.3). DNA from those clones with the desired insert size were
M aterial & M ethods
(ii) In order to screen recombinant E.coli for vectors containing a desired insert,
single colonies were sampled using a sterile toothpick in to lOpl of distilled water in a
0.5 ml Eppendorf tube. The rest of the colony was subcultured on to a numbered
reference plate or inoculated in to LB broth with the appropriate antibiotic. The
inoculated distilled water was heated to 95 °C for 5 minutes in a heat block to lyse the
cells and spun down at 13,000 X g in a benchtop microcentrifuge for 1 minute to clear
any cellular debris. 1 pi of the supernatant was used in a standard PCR. Positive
clones were selected for sequencing (section 2.6).
2 . 4 . 6 Plasmid and cosmid preparation
2 . 4 . 6 . 1 Plasmid and cosmid mini-preps
5 ml of overnight broth culture was pelleted in a 50 ml Falcon tube at
4,000 rpm for 15 minutes in an MSB Mistral 30001 using a swing-out rotor. The
supernatant was discarded and the pellet subjected to a method which is essentially a
scaled down version of the midi-prep method (section 2.4.6.2).
The procedure for plasmids was performed initially with user-prepared
solutions and latterly with the Magic/Wizard Miniprep kits (Promega). The kit was
used exactly according to the manufacturer's instructions. Distilled water was heated to
80 °C before elution of DNA from the spin columns provided.
The non-kit protocol comprised the resuspension, lysis and macromolecule
removal steps using solutions I, II and HI as for the midi-prep. At this point, the pellet
was spun down at 13,000 rpm in a benchtop microcentrifuge for 5 minutes, the
supernatant was removed and subjected to a phenol: chloroform (1:1 v/v) extraction
followed by an sodium acetate/isopropanol precipitation (section 2.4.6.2). The pellet
was washed in 70% ethanol before being dried and resuspended in 25pl TE or distilled
water.
The plasmid and cosmid yields were quantitated by agarose gel electrophoresis
as in section 2.3.3.
2 . 4 . 6 . 2 Plasmid midi-preps
One technique for preparing plasmid DNA for digestion and sequencing
reactions was a mid-range (midi) preparation technique modified from an alkaline-SDS
method described by Bimboim and Doly (1979).
A 50 ml overnight culture was centrifuged at 3,000 X g for 10 minutes, and the
resultant cell pellet was resuspended in Solution I (4 ml). Chromosomal and other
macromolecular components were denatured on ice with 8 ml of Solution II for 5
minutes, and precipitated on ice with high salt Solution HI (4 ml) for 15 minutes. The
sample was then centrifuged at 3,000 X g for 10 minutes, and the supernatant collected.
Plasmid DNA was precipitated from the supernatant with 0.6 volumes of isopropanol
and pelleted at 3,000 X g for 10 minutes. The supernatant was removed and the pellet
was dissolved in 4 ml of TE buffer and extracted with an equal volume of phenol.
DNA was then precipitated with 0.1 volumes of sodium acetate and 2 volumes of
absolute alcohol.
The DNA was pelleted at 10,000 X g and resuspended in 400 fil of TE buffer.
At this stage contaminating RNA and protein was digested, firstly by incubation with
RNAse A (0.5 mg/ml) and 3M sodium acetate (15 |il) at 37 °C for 30 minutes,
followed by incubation with proteinase K (100 |ig/|il) again at 37 °C for 30 minutes.
Following phenol/chloroform purification (section 2.6.3.1), the DNA was pelleted at
14,000 X g for 5 minutes, and washed in 70 % alcohol before air drying and
resuspension in an appropriate volume of TE buffer.
Yield was estimated by agarose gel electrophoresis of 2 |xl of the preparation
along with known quantities of molecular weight standards (X / ffintÛII).
2 . 4 . 6 3 Geneclean II kit
The Geneclean II kit (Bio 101, La Jolla, California) was employed essentially as
per instructions provided by the supplier. The kit was used to purify DNA from a
heterogeneous mixture of proteins, RNA, and other organic materials, usually
M aterial & Methods
2 . 4 . 7 Southern blotting
2 . 4 . 7 . 1 DNA dénaturation
Electrophoresed DNA was denatured before blotting by immersing the gels in
dénaturer (see appendix B) for 30 minutes. After rinsing in distilled water the gels were
immersed in neutraliser. The pH of the gels was monitored using litmus paper, but two
incubation periods each of 15 minutes with a fresh buffer exchange were routinely
used. Gels for transfer on to Hybond-N or Hybond-N+ (Amersham) were then rinsed
in 20 X SSC and assembled for transfer using the same buffer.
2 . 4 . 7 . 2 Capillary transfer
Capillary transfer of DNA from an agarose gel to a membrane was first
described by Southern (1975). Although based on the same principles, the techniques
described below have since been developed to be membrane specific.
Equilibrated gels were placed on a wick of 3MM Whatman paper which was
assembled over a reservoir of 20 X SSC. Membranes were cut to exactly the same size
as the gel and placed on top. This assembly was then covered with a further two pieces
of 3mm Whatman paper soaked in transfer buffer. Care was taken throughout not to
introduce bubbles between the various layers. A stack of paper towels were then placed
on top to a height of several inches and a uniform weight (500-750 g) was added.
Transfer was accomplished overnight, after which the membrane was marked by
clipping the top right-hand comer, for orientation purposes. The DNA was fixed to the
membrane according to manufacturers instructions by either baking at 80 °C for 2
hours or by UV cross-linking after drying at 80 °C for 15 minutes with an Amersham
UV Crosslinker set for 70,000 |LiJ/cm^.
2 . 4 . 7 . 3 Alkali transfer
Certain gels were placed without prior treatment on to the Southern transfer
apparatus as in 2.4.7.2 but using 0.4 M sodium hydroxide as the transfer agent. The
only requirement of this set-up was the need to use Hybond N+ membranes. After
transfer the membrane was washed in 2 X SSC. UV crosslinking with an Amersham
UV Crosslinker set for 70,000 pJ/cm^ was preceded by drying at 80 °C for 15
minutes.
2 . 4 . 8 Probe preparation
For Southern blots or library screening, probes used were generated by PCR
from gDNA templates or plasmid clones. The desired band was then purified before
labelling.
2 . 4 . 8 . 1 Purification of probe template using an LMT agarose gel
The method is modified from Sambrook et al. (1989). PCR-generated DNA
fragments were electrophoresed through a 1.2% low melting temperature agarose gel
(NuSieve; PMC). After staining with ethidium bromide, the insert DNA was visualised
under UV light and carefully cut out of the gel in a minimal volume of agarose. This
procedure was carried out as rapidly as possible to avoid overexposure of the DNA to
UV light. A volume of TE buffer or distilled water was added on the basis of 3 pl/mg
of agarose slice and the agarose DNA plug was then incubated at 65 °C for 10 minutes
to melt the gel. In order to estimate the concentration of the DNA, aliquots were then
electrophoresed in a 1.2% agarose gel alongside known quantities of 0 x ll4 /H a e lll
molecular standards. The stock of template for labelling was then split in to 30-50 pi
aliquots and stored at -20 °C.
2 . 4 . 8 . 2 Radioisotopic labelling of probes
The method is based on the “random priming” procedure developed by Feinberg
and Vogelstein (1983, 1984) where random hexanucleotides are annealed to denatured
template strands and [a-^^PJdCTP is incorporated in to the new complementary strands
by the action of the Klenow Fragment of E. coli DNA polymerase I. The reagents were
supplied in kits by Pharmacia, either in aqueous form or in a vitrified state (Ready To
M aterial & Methods
with distilled water before being heated to 95 °C for 5 minutes, then placed on ice for
several minutes. The template was further mixed with 9 |il of reaction buffer containing
the random hexanucleotides, 5-10 units of Klenow Fragment, 40-50 jiCi of [a-
32p]dCTP of specific activity 6000 Ci/mmol to a total volume of 50 |xl (for aqueous
kit), or by the addition of just the radioisotope (vitrified kit), and incubated at 37 °C for
between 15 minutes and an hour.
2 . 4 . 8 . 3 Radioisotopic labelling of Xt H i n d l l l markers
This procedure incorporates [a-32p]dATP (specific activity 3000 Ci/mmol) into
fragments of the digest since they aU have a 3' overhang which can be filled in using
Klenow DNA polymerase. The reaction was performed at room temperature for 10
minutes in H ind\l\ buffer with 2 |xCi [a-^^PjdATP, 1 pg of 1 HindGl and 2U Klenow
DNA polymerase (Pharmacia). A 5 pi aliquot was removed and the remainder stored at
-20 °C. Prior to agarose gel electrophoresis the aliquot was denatured in 0.1 M sodium
hydroxide for 15 minutes and mixed with 0.1 volumes of 10 X loading buffer.
2 . 4 . 8 . 4 Estimation of incorporation of radioisotope into the synthesised probe
After incubation, 1 pi of the labelling reaction was carefully spotted on to the
centre of a glass microfibre filter (Whatman GF/B) and a hand held monitor clamped
above it such that the meter was reading approximately 100 counts per second. The
filter was then washed with 10 ml of ice cold 5% (v/v) TCA which was drawn through
the filter by a vacuum. The filter was then replaced in the same position underneath the
monitor and the new meter reading recorded. The specific activity (SA) of the probe
could then be estimated, using the following formula :-,
Di
-H f ( 4 X
[ 'Where fiCi = )LiCi of dCTP in reaction
F = Fraction of input label incorporated in to DNA
Di = Mass of input DNA template (ng)
S = Specific activity of dCTP (Ci/mmol)
325 = Average molar mass of a deoxyribonucleotide
Thus, for 50 ng of template at 50 % incorporation of 50 |iCi of dCTP, SA is
approximately lxl0^dpm /|ig of DNA, whilst for 100 ng, it drops to 5.2x10^ dpm/|ig.
All probes used exceeded 50 % incorporation.
2 . 4 . 8 . 5 Purification of labelled probe
Pharmacia NICK translation columns or S400 micro-spin columns were used
exactly according to the manufacturer's protocols to separate the desired probe from the
unincorporated nucleotides and hexamers.
2 . 4 . 8 . 6 Nucleic acid hybridisation to Southern blots
The method is modified from Sambrook et al. (1989). Hybond-N and -N+
filters were prehybridised for at least 10 minutes at the hybridisation temperature in 30
ml of a solution containing either, 10% dextran sulphate, 6X SSC, 0.5% (w/v) SDS,
125|ig/ml denatured herring sperm DNA and 5X Denhardfs reagent, or Church's
solution (50 ml of 0.5M sodium phosphate buffer pH7.2, 7% SDS, 1 mM EDTA
(Church and Gilbert, 1984)). The volume was reduced to 20 ml and 50-100 ng of heat
denatured oligo-labelled PCR product (or 2-4 ng of oligo-labelled marker (e.g. 1 kb
marker ladder)) was added and carefully mixed. Hybridisation was carried out
overnight at the hybridisation temperature (generally between 58 °C to 65 °C).
Filters were then rinsed twice in 100 ml 2X SSC immediately following
hybridisation. Washes consisted of a single wash at room temperature with